Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-318-3p URS000033D06C_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACUGGGCUUUGUUUAUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bactrocera dorsalis bdo-miR-318
  2. Drosophila ananassae dan-miR-318
  3. Drosophila erecta der-miR-318
  4. Drosophila grimshawi dgr-miR-318
  5. Drosophila mojavensis dmo-miR-318
  6. Drosophila persimilis dpe-miR-318
  7. Drosophila pseudoobscura dps-miR-318
  8. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294389_df_nrg
  9. Drosophila sechellia dse-miR-318
  10. Drosophila simulans dsi-miR-318
  11. Drosophila virilis dvi-miR-318
  12. Drosophila willistoni dwi-miR-318
  13. Drosophila yakuba dya-miR-318
Publications