Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR535-3p URS0000338E10_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR535-3p: Osa-mir535-3p is a miRNA that is involved in regulating abiotic and biotic stress responses, but its role in seed development has not yet been determined [PMC10116700]. Osa-mir535-3p is part of a set of miRNAs that includes osa-miR319a-3p, osa-miR1848, osa-miR1872, osa-miR1874, and osa-miR5504 [PMC10116700]. It has been found that Osa-mir535-3p is one of the twenty-six common miRNAs that show preferential expression in fungal-infected resistant genotypes [PMC7662745]. Additionally, Osa-mir535-3p has been identified as one of the miRNAs involved in regulating rice immunity against M. oryzae [PMC7662745]. In a study on subfamily III members, it was discovered that OsHDZIP9 was targeted by several miRNA families including osa-mir535-3p [PMC9405480]. In terms of expression patterns, it was found that Osa-mir535-3p showed similar expression patterns to conserved miRNAs such as osa-miR164a and osa-miR171b [PMC9597502]. Finally, Venn analysis revealed that Osa-mir535-3p was one of the eight co-up-regulated miRNAs in each stage compared to diploid rice [PMC5295217]. References: [PMC10116700]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10116700/ [PMC7662745]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7662745/ [PMC9405480]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9405480/ [PMC9597502]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9597502/ [PMC5295217]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5295217/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUUUCUCCCGUUGUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR535-3p
Publications