Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-122-5p URS00003380CC_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (PSICQUIC, RefSeq, TarBase, LncBase, PirBase, ENA, MirGeneDB, miRBase). Described in 51 papers. Mus musculus (house mouse) mmu-miR-122-5p sequence is a product of Mir122, miR-122, miR-122-5p, mmu-miR-122-5p, mmu-miR-122 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including -14 gene, 0610006H10Rik, 0610006N12Rik, 0610006O14Rik, 0610007H10Rik, 0610007I11Rik, 0610007K21Rik, 0610007P08Rik, 0610008C09Rik, 0610008D19Rik.

Interactions 12

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-122-5p interacts with:

Interaction id Participant Synonyms
URS00003380CC_10090-6 G5E8G5 G5E8G5
URS00003380CC_10090-0 G5E8G5 G5E8G5
URS00003380CC_10090-7 P05064 P05064
URS00003380CC_10090-1 P05064 P05064
URS00003380CC_10090-8 P09242 P09242
URS00003380CC_10090-2 P09242 P09242
URS00003380CC_10090-9 Q06831 Q06831
URS00003380CC_10090-3 Q06831 Q06831
URS00003380CC_10090-4 Q8BPQ2 Q8BPQ2
URS00003380CC_10090-10 Q8BPQ2 Q8BPQ2
URS00003380CC_10090-5 Q9CZU6 Q9CZU6
URS00003380CC_10090-11 Q9CZU6 Q9CZU6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAGUGUGACAAUGGUGUUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 62 other species

    1. Alligator mississippiensis ami-miR-122-5p
    2. Anolis carolinensis aca-miR-122-5p
    3. Bos taurus (cattle) bta-miR-122
    4. Callithrix jacchus cja-miR-122
    5. Canis lupus familiaris cfa-miR-122
    6. Capra hircus chi-miR-122
    7. Cavia porcellus (domestic guinea pig) cpo-miR-122-5p
    8. Cervus elaphus (red deer) cel-miR-122
    9. Chrysemys picta bellii Cpi-Mir-122_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-122-5p
    11. Columba livia (rock pigeon) cli-miR-122-5p
    12. Danio rerio (zebrafish) dre-miR-122
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-122-5p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
    15. Equus caballus (horse) eca-miR-122
    16. Gadus morhua gmo-miR-122-5p
    17. Gallus gallus (chicken) Gga-Mir-122-P1_5p (mature (guide))
    18. Gorilla gorilla (western gorilla) ggo-miR-122
    19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
    20. Homo sapiens hsa-miR-122-5p
    21. Macaca mulatta mml-miR-122a-5p
    22. Maylandia zebra mze-miR-122
    23. Neolamprologus brichardi nbr-miR-122
    24. Oreochromis niloticus oni-miR-122
    25. Ornithorhynchus anatinus oan-miR-122-5p
    26. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
    27. Pan troglodytes (chimpanzee) ptr-miR-122
    28. Paralichthys olivaceus (Japanese flounder) pol-miR-122-5p
    29. Pongo pygmaeus ppy-miR-122
    30. Pteropus alecto pal-miR-122-5p
    31. Pundamilia nyererei pny-miR-122
    32. Python bivittatus pbv-miR-122-5p
    33. Rattus norvegicus rno-miR-122-5p
    34. Salmo salar (Atlantic salmon) ssa-miR-122-5p
    35. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
    36. Takifugu rubripes (torafugu) fru-miR-122
    37. Tetraodon nigroviridis tni-miR-122
    38. Tor tambroides miR-122
    39. Tursiops truncatus miR-122-5p
    40. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))