Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Paralichthys olivaceus (Japanese flounder) pol-miR-1-5p URS0000332B22_8255

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAUACUUCUUUAUAUGCCCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Chiloscyllium plagiosum microRNA cpl-miR-1-5p
  2. Chrysemys picta cpi-miR-1a-5p
  3. Columba livia (rock pigeon) cli-miR-1a-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1-5p
  5. Gallus gallus (chicken) gga-miR-1a-1-5p
  6. Ictalurus punctatus (channel catfish) ipu-miR-1
  7. Macaca mulatta (Rhesus monkey) mml-miR-1-1-5p
  8. Mus musculus (house mouse) mmu-miR-1a-1-5p
  9. Ophiophagus hannah (king cobra) oha-miR-1b-5p
  10. Salmo salar (Atlantic salmon) ssa-miR-1-4-5p
  11. Taeniopygia guttata tgu-miR-1-1-5p