Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-miR-27b-5p URS0000330617_8030

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGCUUAGCUGAUUGGUGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis (American alligator) ami-miR-27b-5p
  2. Anolis carolinensis aca-miR-27b-5p
  3. Capra hircus (goat) chi-miR-27b-5p
  4. Cervus elaphus (red deer) cel-miR-27b*
  5. Chrysemys picta cpi-miR-27b-5p
  6. Cricetulus griseus cgr-miR-27b-5p
  7. Homo sapiens (human) hsa-miR-27b-5p
  8. Mus musculus (house mouse) mmu-miR-27b-5p
  9. Ornithorhynchus anatinus (platypus) oan-miR-27b-5p
  10. Pteropus alecto pal-miR-27b-5p
  11. Taeniopygia guttata (zebra finch) tgu-miR-27-5p