Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) ami-miR-27b-5p URS0000330617_8496

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Alligator mississippiensis. Annotated by 2 databases (miRBase, MirGeneDB). Described in 1 paper.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAGCUUAGCUGAUUGGUGAAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Anolis carolinensis aca-miR-27b-5p
    2. Capra hircus chi-miR-27b-5p
    3. Cervus elaphus (red deer) cel-miR-27b*
    4. Chrysemys picta (Painted turtle) cpi-miR-27b-5p
    5. Cricetulus griseus cgr-miR-27b-5p
    6. Homo sapiens hsa-miR-27b-5p
    7. Mus musculus (house mouse) mmu-miR-27b-5p
    8. Ornithorhynchus anatinus oan-miR-27b-5p
    9. Pteropus alecto pal-miR-27b-5p
    10. Salmo salar (Atlantic salmon) ssa-miR-27b-5p
    11. Taeniopygia guttata (zebra finch) tgu-miR-27-5p