Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-27b-5p URS0000330617_10029

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Cricetulus griseus. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Cricetulus griseus (Chinese hamster) cgr-miR-27b-5p sequence is a product of miR-27, cgr-miR-27b-5p, miR-27b-5p, miR-27b, Mir27b, cgr-miR-27b genes. Found in the chinese hamster reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAGCUUAGCUGAUUGGUGAAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Alligator mississippiensis ami-miR-27b-5p
    2. Anolis carolinensis aca-miR-27b-5p
    3. Capra hircus chi-miR-27b-5p
    4. Cervus elaphus (red deer) cel-miR-27b*
    5. Chrysemys picta (Painted turtle) cpi-miR-27b-5p
    6. Homo sapiens hsa-miR-27b-5p
    7. Mus musculus (house mouse) mmu-miR-27b-5p
    8. Ornithorhynchus anatinus oan-miR-27b-5p
    9. Pteropus alecto pal-miR-27b-5p
    10. Salmo salar (Atlantic salmon) ssa-miR-27b-5p
    11. Taeniopygia guttata (zebra finch) tgu-miR-27-5p