Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-957-3p URS000032E183_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAACCGUCCAAAACUGAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Aedes aegypti aae-miR-957
  2. Anopheles gambiae aga-miR-957
  3. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-957
  4. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-957
  5. Culex quinquefasciatus cqu-miR-957
  6. Drosophila ananassae Dan-Mir-957_3p (mature (guide))
  7. Drosophila mojavensis Dmo-Mir-957_3p (mature (guide))
  8. Drosophila pseudoobscura dps-miR-957-3p
  9. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331135_df_nrg
  10. Drosophila simulans dsi-miR-957
  11. Drosophila virilis dvi-miR-957-3p
  12. Drosophila yakuba Dya-Mir-957-P1_3p (mature (guide))
Publications