Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Python bivittatus (Burmese python) pbv-miR-133b-3p URS000032BD73_176946

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Python bivittatus. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGGUCCCCUUCAACCAGCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Alligator mississippiensis ami-miR-133b-3p
    2. Bos taurus (cattle) bta-miR-133b
    3. Canis lupus familiaris cfa-miR-133b
    4. Cavia porcellus (domestic guinea pig) cpo-miR-133b-3p
    5. Chrysemys picta bellii Cpi-Mir-133-P3-v1_3p (mature (guide))
    6. Columba livia (rock pigeon) cli-miR-133b-3p
    7. Danio rerio (zebrafish) dre-miR-133b-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-133b-3p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P3-v1_3p (mature (guide))
    10. Equus caballus (horse) eca-miR-133b
    11. Gallus gallus (chicken) Gga-Mir-133-P3-v1_3p (mature (guide))
    12. Homo sapiens hsa-miR-133b
    13. Macaca mulatta mml-miR-133b-3p
    14. Mus musculus (house mouse) mmu-miR-133b-3p
    15. Ornithorhynchus anatinus oan-miR-133b-3p
    16. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
    17. Pan troglodytes (chimpanzee) ptr-miR-133b
    18. Pongo pygmaeus ppy-miR-133b
    19. Rattus norvegicus rno-miR-133b-3p
    20. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P3-v1_3p (mature (guide))
    21. Tor tambroides miR-133b-3p
    22. Xenopus tropicalis Xtr-Mir-133-P3-v1_3p (mature (guide))