Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-133b-3p URS000032BD73_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (PirBase, LncBase, MirGeneDB, PSICQUIC, TarBase, RefSeq, miRBase, ENA). Described in 30 papers. Mus musculus (house mouse) mmu-miR-133b-3p sequence is a product of Mir133b, miR-133b-3p, miR-133, mmu-miR-133b, miR-133b, mmu-miR-133b-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (P)RR, 0610007D13Rik, 0610009O03Rik, 0610011C06Rik, 0610011D08Rik, 0610011N22Rik, 0610013E23Rik, 0610013I17Rik, 0610020I02Rik, 0610025G21Rik.

Interactions 6

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-133b-3p interacts with:

Interaction id Participant Synonyms
URS000032BD73_10090-0 P16092 P16092
URS000032BD73_10090-3 P16092 P16092
URS000032BD73_10090-1 P62715 P62715
URS000032BD73_10090-4 P62715 P62715
URS000032BD73_10090-2 P63330 P63330
URS000032BD73_10090-5 P63330 P63330

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGGUCCCCUUCAACCAGCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Alligator mississippiensis ami-miR-133b-3p
    2. Bos taurus (cattle) bta-miR-133b
    3. Canis lupus familiaris cfa-miR-133b
    4. Cavia porcellus (domestic guinea pig) cpo-miR-133b-3p
    5. Chrysemys picta bellii Cpi-Mir-133-P3-v1_3p (mature (guide))
    6. Columba livia (rock pigeon) cli-miR-133b-3p
    7. Danio rerio (zebrafish) dre-miR-133b-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-133b-3p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P3-v1_3p (mature (guide))
    10. Equus caballus (horse) eca-miR-133b
    11. Gallus gallus (chicken) Gga-Mir-133-P3-v1_3p (mature (guide))
    12. Homo sapiens hsa-miR-133b
    13. Macaca mulatta mml-miR-133b-3p
    14. Ornithorhynchus anatinus oan-miR-133b-3p
    15. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
    16. Pan troglodytes (chimpanzee) ptr-miR-133b
    17. Pongo pygmaeus ppy-miR-133b
    18. Python bivittatus pbv-miR-133b-3p
    19. Rattus norvegicus rno-miR-133b-3p
    20. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P3-v1_3p (mature (guide))
    21. Tor tambroides miR-133b-3p
    22. Xenopus tropicalis Xtr-Mir-133-P3-v1_3p (mature (guide))