Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-17 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-17 precursor URS000032AA22_9606

  • 84 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 74 species

Automated summary: This pre miRNA sequence is 84 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, miRBase, HGNC, MalaCards, Ensembl/GENCODE, ENA, GeneCards, Ensembl). Described in 50 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-17, RF00051). Homo sapiens (human) microRNA hsa-mir-17 precursor sequence is a product of hsa-mir-17 precursor, mir-17 precurso, MIR17, mir-17, mir-17 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 73 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 17 (MIR17)
    2. Aotus nancymaae miRNA
    3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-17 precursor
    4. Bison bison bison (American bison) miRNA
    5. Bos indicus x Bos taurus microRNA 17
    6. Bos mutus miRNA
    7. Bos taurus (cattle) microRNA bta-mir-17 precursor
    8. Callithrix jacchus miRNA
    9. Camelus dromedarius (Arabian camel) microRNA 17
    10. Canis lupus dingo microRNA 17
    11. Canis lupus familiaris microRNA 17
    12. Carlito syrichta (Philippine tarsier) miRNA
    13. Castor canadensis miRNA
    14. Cavia porcellus microRNA 17
    15. Cercocebus atys (Sooty mangabey) miRNA
    16. Cervus hanglu yarkandensis (Yarkand deer) miRNA
    17. Chinchilla lanigera (Long-tailed chinchilla) miRNA
    18. Chlorocebus sabaeus (African green monkey) miRNA
    19. Colobus angolensis palliatus miRNA
    20. Dasypus novemcinctus (nine-banded armadillo) miRNA
    21. Delphinapterus leucas microRNA 17
    22. Dipodomys ordii miRNA
    23. Erinaceus europaeus (western European hedgehog) miRNA
    24. Felis catus (domestic cat) miRNA
    25. Fukomys damarensis (Damara mole rat) miRNA
    26. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-17
    27. Gorilla gorilla microRNA ggo-mir-17 precursor
    28. Heterocephalus glaber miRNA
    29. Ictidomys tridecemlineatus miRNA
    30. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-17 precursor
    31. Lemur catta (Ring-tailed lemur) microRNA lca-mir-17 precursor
    32. Lynx canadensis (Canada lynx) microRNA 17
    33. Macaca fascicularis miRNA
    34. Macaca mulatta microRNA mml-mir-17 precursor
    35. Macaca nemestrina microRNA mne-mir-17 precursor
    36. Mandrillus leucophaeus (Drill) miRNA
    37. Marmota marmota marmota microRNA 17
    38. Microcebus murinus miRNA
    39. Mustela putorius furo (Domestic ferret) miRNA
    40. Neovison vison miRNA
    41. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    42. Octodon degus (Degu) miRNA
    43. Oryctolagus cuniculus (rabbit) microRNA 17
    44. Otolemur garnettii (small-eared galago) miRNA
    45. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-17 precursor
    46. Panthera leo (lion) microRNA 17
    47. Panthera pardus microRNA 17
    48. Panthera tigris altaica (Tiger) miRNA
    49. Pan troglodytes (chimpanzee) microRNA ptr-mir-17 precursor
    50. Papio anubis (Olive baboon) miRNA
    51. Phocoena sinus (vaquita) miRNA
    52. Physeter catodon (sperm whale) microRNA 17
    53. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    54. Prolemur simus miRNA
    55. Propithecus coquereli (Coquerel's sifaka) miRNA
    56. Pteropus vampyrus miRNA
    57. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 17
    58. Rhinopithecus bieti miRNA
    59. Rhinopithecus roxellana miRNA
    60. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-17 precursor
    61. Saimiri boliviensis boliviensis miRNA
    62. Sciurus vulgaris miRNA
    63. Sorex araneus miRNA
    64. Spermophilus dauricus miRNA
    65. Theropithecus gelada microRNA 17
    66. Tupaia belangeri miRNA
    67. Tursiops truncatus (bottlenosed dolphin) miRNA
    68. Urocitellus parryii miRNA
    69. Ursus americanus (American black bear) miRNA
    70. Ursus maritimus (Polar bear) miRNA
    71. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 17
    72. Vicugna pacos (alpaca) miRNA
    73. Vulpes vulpes miRNA
    74. Zalophus californianus miRNA
    2D structure New