Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-92a-3p URS0000329B12_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, IntAct, PirBase, ENA, TarBase, LncBase). Described in 51 papers. Mus musculus (house mouse) mmu-miR-92a-3p sequence is a product of mmu-miR-92a-3p, miR-92a-3p, Mir92-1, Mir92-2, miR-92a, miR-92, mmu-miR-92a genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610009H04Rik, 0610009I16Rik, 0610012D09Rik, 0610020I02Rik, 0610030A03Rik, 0610030G24Rik, 0610033H09Rik, 0610038K04Rik, 0610038M03Rik.

Interactions 1

According to IntAct, Mus musculus (house mouse) mmu-miR-92a-3p interacts with:

IntAct ID Participant Synonyms
EBI-21995355 intact:EBI-22015195 EBI-22015195 ENSMUST00000107679.7 mrna_fbw7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCACUUGUCCCGGCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5 other species

    1. Capra hircus miR-92
    2. Gallus gallus (chicken) gga-miR-92-3p
    3. Oryzias latipes ola-miR-92a
    4. Ovis aries miscellaneous RNA
    5. Rattus norvegicus rno-miR-92a-3p
    6. Xenopus tropicalis (tropical clawed frog) xtr-miR-92a