Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7b-5p URS0000324096_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, GeneCards, IntAct, MirGeneDB, ENA, MalaCards, RefSeq, miRBase, PSICQUIC, TarBase). Homo sapiens (human) hsa-let-7b-5p sequence is a product of let-7b, let-7b-5p, MIRLET7B, hsa-let-7b, let-7, hsa-let-7b-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 12CC4, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 15.5K, 15E1.2, 16.3A5, 16A.

Interactions 12

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-let-7b-5p interacts with:

Interaction id Participant Synonyms
EBI-25592190 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-25592148 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25591213 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25592345 intact:EBI-25592332 EBI-25592332 ENST00000382199 mrna_igf2bp2
EBI-25592341 intact:EBI-25592349 EBI-25592349 ENST00000261254 mrna_ccnd2
URS0000324096_9606-0 P05231 P05231
URS0000324096_9606-4 P05231 P05231
URS0000324096_9606-1 P36897 P36897
URS0000324096_9606-5 P42574 P42574
URS0000324096_9606-2 P42574 P42574
URS0000324096_9606-6 Q9H9Z2 Q9H9Z2
URS0000324096_9606-3 Q9H9Z2 Q9H9Z2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGGUUGUGUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 321 other species

    1. Alligator mississippiensis ami-let-7b-5p
    2. Anolis carolinensis (green anole) Aca-Let-7-P2b2_5p (mature (guide))
    3. Bos taurus (cattle) bta-let-7b
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7b
    5. Canis lupus familiaris (dog) cfa-let-7b
    6. Capra hircus chi-let-7b-5p
    7. Cavia porcellus cpo-let-7b-5p
    8. Chrysemys picta bellii Cpi-Let-7-P2b2_5p (mature (guide))
    9. Chrysemys picta cpi-let-7b-5p
    10. Cricetulus griseus (Chinese hamster) cgr-let-7b
    11. Cyprinus carpio ccr-let-7b
    12. Danio rerio dre-let-7b
    13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7b-5p
    14. Daubentonia madagascariensis dma-let-7b
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2b2_5p (mature (guide))
    16. Gadus morhua (Atlantic cod) Gmo-Let-7-P2b2a_5p (mature (guide))
    17. Gallus gallus gga-let-7b
    18. Gekko japonicus Gja-Let-7-P2b2_5p (mature (guide))
    19. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7b
    20. Latimeria chalumnae Lch-Let-7-P2b2_5p (mature (guide))
    21. Lepisosteus oculatus Loc-Let-7-P2b2_5p (mature (guide))
    22. Macaca mulatta mml-let-7b-5p
    23. Maylandia zebra mze-let-7b
    24. Microcaecilia unicolor Mun-Let-7-P2b2_5p (mature (guide))
    25. Microcebus murinus mmr-let-7b
    26. Monodelphis domestica mdo-let-7b
    27. Monopterus albus (swamp eel) Mal-Let-7-P2b2b_5p (mature (guide))
    28. Mus musculus mmu-let-7b-5p
    29. Neolamprologus brichardi nbr-let-7b
    30. Ophiophagus hannah oha-let-7b-5p
    31. Oreochromis niloticus oni-let-7b
    32. Ornithorhynchus anatinus (platypus) oan-let-7b-5p
    33. Oryctolagus cuniculus ocu-let-7b-5p
    34. Otolemur garnettii (small-eared galago) oga-let-7b
    35. Ovis aries microRNA let-7b
    36. Pan paniscus (pygmy chimpanzee) ppa-let-7b
    37. Pan troglodytes (chimpanzee) ptr-let-7b
    38. Papio hamadryas pha-let-7b
    39. Paralichthys olivaceus pol-let-7b-5p
    40. Pongo pygmaeus (Bornean orangutan) ppy-let-7b
    41. Pundamilia nyererei pny-let-7b
    42. Python bivittatus (Burmese python) pbv-let-7b-5p
    43. Rattus norvegicus rno-let-7b-5p
    44. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-let-7b
    45. Salmo salar (Atlantic salmon) ssa-let-7b-5p
    46. Sarcophilus harrisii Sha-Let-7-P2b2_5p (mature (guide))
    47. Sphenodon punctatus (tuatara) Spt-Let-7-P2b2_5p (mature (guide))
    48. Taeniopygia guttata (zebra finch) tgu-let-7b-5p
    49. Takifugu rubripes (torafugu) fru-let-7b
    50. Tetraodon nigroviridis (spotted green pufferfish) tni-let-7b
    51. Tor tambroides let-7b
    52. Xenopus laevis (African clawed frog) Xla-Let-7-P2b2c_5p (mature (guide))
    53. Xenopus tropicalis Xtr-Let-7-P2b2_5p (mature (guide))
    Publications New