Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3171 URS000031F6C2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3171: Hsa-mir-3171 is a miRNA that has been identified as one of the differential miRNAs in liver cancer patients with low and high tumor mutational burden (TMB) [PMC7355149]. It is involved in the formative process of liver cancer [Chen, 2009] and has been found to have a decreased expression level in atrial fibrillation (AF) [PMC6584754]. Hsa-mir-3171 interacts with certain circRNAs, such as hsa_circRNA_100612, and is involved in regulating gene expression, such as the SLC1A3 gene [PMC6584754] [PMC8858317]. Additionally, hsa-mir-3171 has been found to interact with other miRNAs that are associated with atrial fibrillation, including hsa-miR-892a and hsa-miR-133b [PMC7390851]. These findings suggest that hsa-mir-3171 plays a role in the development and progression of liver cancer and atrial fibrillation. Further research is needed to fully understand the mechanisms by which hsa-mir-3171 functions in these diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUGUAUGGAAUCUGUAUAUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications