Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-126a-3p URS000031D65D_7955

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Danio rerio. Annotated by 4 databases (miRBase, PSICQUIC, ENA, RefSeq). Described in 24 papers. Danio rerio (zebrafish) dre-miR-126a-3p sequence is a product of dre-miR-126a-3p, mir126a, dre-miR-126a, miR-126a-3p, miR-126, miR-126a genes. Found in the zebrafish reference genome.

Interactions 6

According to PSICQUIC, Danio rerio (zebrafish) dre-miR-126a-3p interacts with:

Interaction id Participant Synonyms
URS000031D65D_7955-0 A5PMX0 A5PMX0
URS000031D65D_7955-3 A5PMX0 A5PMX0
URS000031D65D_7955-1 B3DHG9 B3DHG9
URS000031D65D_7955-4 B3DHG9 B3DHG9
URS000031D65D_7955-2 F1R8L9 F1R8L9
URS000031D65D_7955-5 F1R8L9 F1R8L9

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGUACCGUGAGUAAUAAUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Callorhinchus milii eshark_mir-126_1
    2. Capra hircus chi-miR-126-3p
    3. Chiloscyllium plagiosum microRNA cpl-miR-126
    4. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8229149
    5. Ovis aries miscellaneous RNA
    6. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62990
    7. Takifugu rubripes (torafugu) fru-miR-126
    8. Tetraodon nigroviridis tni-miR-126
    9. Tor tambroides (Thai mahseer) miR-126a-3p
    10. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-3p