Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-216a URS0000318E24_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 3 databases (ENA, RefSeq, miRBase). Danio rerio (zebrafish) dre-miR-216a sequence is a product of miR-216, miR-216a, mir216a-1, dre-miR-216a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAUCUCAGCUGGCAACUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Anolis carolinensis aca-miR-216a
    2. Bos taurus bta-miR-216a
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-216a
    4. Callorhinchus milii (elephant shark) eshark_mir-216_2
    5. Canis lupus familiaris Cfa-Mir-216-P1a_5p (mature (guide))
    6. Chrysemys picta cpi-miR-216a-5p
    7. Columba livia (rock pigeon) cli-miR-216a-5p
    8. Equus caballus (horse) eca-miR-216a
    9. Homo sapiens (human) hsa-miR-216a-5p
    10. Ictalurus punctatus ipu-miR-216a
    11. Macaca mulatta (Rhesus monkey) mml-miR-216a-5p
    12. Mus musculus (house mouse) mmu-miR-216a-5p
    13. Ornithorhynchus anatinus oan-miR-216a-5p
    14. Python bivittatus (Burmese python) pbv-miR-216a-5p
    15. Rattus norvegicus (Norway rat) rno-miR-216a-5p
    16. Salmo salar ssa-miR-216b-5p
    17. Scyliorhinus torazame (cloudy catshark) Sto-Mir-216-P1a_5p (mature (guide))
    18. Taeniopygia guttata tgu-miR-216a-5p
    19. Tor tambroides miR-216a
    20. Xenopus laevis (African clawed frog) xla-miR-216
    21. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3673470
    Publications New