Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-26b-5p URS0000316FA5_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, IntAct, RefSeq, TarBase, GeneCards, MalaCards, miRBase, LncBase, PSICQUIC). Described in 74 papers. Homo sapiens (human) hsa-miR-26b-5p sequence is a product of miR-26, miR-26b-5p, hsa-miR-26b-5p, hsa-miR-26b, miR-26b, MIR26B genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8U, 101F6, 133K02, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 16A, 17-BETA-HSD11, 17-BETA-HSDXI, 182-FIP.

Interactions 5

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-26b-5p interacts with:

Interaction id Participant Synonyms
EBI-16803357 intact:EBI-16803360 EBI-16803360 ENST00000368723.3 mrna_s100a7
URS0000316FA5_9606-0 O00206 O00206
URS0000316FA5_9606-2 O00206 O00206
URS0000316FA5_9606-1 P06400 P06400
URS0000316FA5_9606-3 P06400 P06400

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCAAGUAAUUCAGGAUAGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus (cattle) microRNA miR-26b
    2. Gorilla gorilla (western gorilla) ggo-miR-26b
    3. Macaca mulatta mml-miR-26b-5p
    4. Mus musculus (house mouse) mmu-miR-26b-5p
    5. Ovis aries oar-miR-26b
    6. Pan troglodytes (chimpanzee) ptr-miR-26b
    7. Pongo pygmaeus ppy-miR-26b
    8. Rattus norvegicus rno-miR-26b-5p
    9. Tursiops truncatus miR-26b
    10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2112542