Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-454-5p URS000031602A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-454: Hsa-mir-454 is a microRNA that has been found to be associated with day-3 embryo quality [PMC6242846]. It is one of seven EV-miRNAs that have been identified in this context [PMC6242846]. Additionally, hsa-mir-454 has been found to be down-regulated at TP 2-8 compared to TP 1 in patients without metastases [PMC4599298]. Furthermore, hsa-mir-454 has been identified as one of the miRNAs that may regulate TNF-α expression [PMC7675078]. In a study examining differentially expressed miRNAs, hsa-mir-454 was found to be upregulated in the ceRNA network of BRCA patients aged ≤ 39 years [PMC8097183]. Overall, hsa-mir-454 has been implicated in various biological processes and may have a role in embryo quality, metastasis, TNF-α expression regulation, and BRCA ceRNA networks.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCUAUCAAUAUUGUCUCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications