Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-130a-3p URS0000315338_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, ENA, TarBase, GeneCards, miRBase, LncBase, MalaCards, IntAct, MirGeneDB). Described in 71 papers. Homo sapiens (human) hsa-miR-130a-3p sequence is a product of miR-130a, hsa-miR-130a, miR-130, hsa-miR-130a-3p, MIR130A, miR-130a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 101F6, 156DAG, 15E1.2, 182-FIP, 3-PAP, 3PAP, 4.1-G, 4.1G, 4E-BP1, 54TM.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-miR-130a-3p interacts with:

IntAct ID Participant Synonyms
EBI-25297589 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGUGCAAUGUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-130-P3a_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-130-P1a_3p (mature (guide))
    3. Bos taurus bta-miR-130a
    4. Canis lupus familiaris cfa-miR-130a
    5. Capra hircus miR-130a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-130a-3p
    7. Cervus elaphus cel-miR-130a
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-130-P3a_3p (mature (guide))
    9. Columba livia cli-miR-130a-3p
    10. Cricetulus griseus cgr-miR-130a-3p
    11. Cyprinus carpio (common carp) ccr-miR-130a
    12. Danio rerio (zebrafish) dre-miR-130a
    13. Dasypus novemcinctus dno-miR-130a-3p
    14. Equus caballus (horse) eca-miR-130a
    15. Gallus gallus (chicken) gga-miR-130c-3p
    16. Macaca mulatta Mml-Mir-130-P1a_3p (mature (guide))
    17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-130c-3p
    18. Mus musculus (house mouse) mmu-miR-130a-3p
    19. Ophiophagus hannah oha-miR-130b-3p
    20. Ornithorhynchus anatinus (platypus) oan-miR-130b-3p
    21. Otolemur garnettii oga-miR-130a
    22. Ovis aries miscellaneous RNA
    23. Pan troglodytes (chimpanzee) ptr-miR-130a
    24. Pongo pygmaeus ppy-miR-130a
    25. Pteropus alecto pal-miR-130-3p
    26. Python bivittatus pbv-miR-130d-3p
    27. Rattus norvegicus rno-miR-130a-3p
    28. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-130-P3a_3p (mature (guide))
    29. Sus scrofa (pig) ssc-miR-130a
    30. Taeniopygia guttata (zebra finch) tgu-miR-130c-3p
    31. Tor tambroides miR-130a
    32. Tupaia chinensis (Chinese tree shrew) tch-miR-130a-3p
    33. Xenopus laevis xla-miR-130a
    34. Xenopus tropicalis (tropical clawed frog) xtr-miR-130a