Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-130a-3p URS0000315338_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, TarBase, MirGeneDB, MalaCards, ENA, IntAct, GeneCards, LncBase, miRBase). Homo sapiens (human) hsa-miR-130a-3p sequence is a product of miR-130a-3p, miR-130a, hsa-miR-130a, MIR130A, miR-130, hsa-miR-130a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 101F6, 156DAG, 15E1.2, 182-FIP, 3-PAP, 3PAP, 4.1-G, 4.1G, 4E-BP1, 54TM.

Interactions 26

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-130a-3p interacts with:

Interaction id Participant Synonyms
EBI-25297589 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
URS0000315338_9606-0 O14786 O14786
URS0000315338_9606-13 O14786 O14786
URS0000315338_9606-1 P01137 P01137
URS0000315338_9606-14 P01137 P01137
URS0000315338_9606-15 P01375 P01375
URS0000315338_9606-2 P01375 P01375
URS0000315338_9606-18 P37231 P37231
URS0000315338_9606-5 P37231 P37231
URS0000315338_9606-6 P37231 P37231
URS0000315338_9606-16 P37231 P37231
URS0000315338_9606-17 P37231 P37231
URS0000315338_9606-3 P37231 P37231
URS0000315338_9606-4 P37231 P37231
URS0000315338_9606-7 P38936 P38936
URS0000315338_9606-19 P38936 P38936
URS0000315338_9606-8 P51608 P51608
URS0000315338_9606-20 P51608 P51608
URS0000315338_9606-21 Q13562 Q13562
URS0000315338_9606-9 Q13562 Q13562
URS0000315338_9606-10 Q14116 Q14116
URS0000315338_9606-22 Q14116 Q14116
URS0000315338_9606-23 Q15818 Q15818
URS0000315338_9606-11 Q15818 Q15818
URS0000315338_9606-24 Q8NFP9 Q8NFP9
URS0000315338_9606-12 Q8NFP9 Q8NFP9

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGUGCAAUGUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis Ami-Mir-130-P1b_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-130-P1b_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-130a
    4. Canis lupus familiaris (dog) cfa-miR-130a
    5. Capra hircus (goat) miR-130a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-130a-3p
    7. Cervus elaphus (red deer) cel-miR-130a
    8. Chrysemys picta bellii Cpi-Mir-130-P1b_3p (mature (guide))
    9. Columba livia (rock pigeon) cli-miR-130a-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-130a-3p
    11. Cyprinus carpio ccr-miR-130a
    12. Danio rerio (zebrafish) dre-miR-130a
    13. Dasypus novemcinctus dno-miR-130a-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P1c_3p (mature (guide))
    15. Equus caballus eca-miR-130a
    16. Gallus gallus gga-miR-130c-3p
    17. Gekko japonicus Gja-Mir-130-P1b_3p (mature (guide))
    18. Latimeria chalumnae (coelacanth) Lch-Mir-130-P1b_3p (mature (guide))
    19. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P1b_3p (mature (co-guide))
    20. Macaca mulatta (Rhesus monkey) Mml-Mir-130-P1c_3p (mature (guide))
    21. Microcaecilia unicolor Mun-Mir-130-P1b_3p (mature (guide))
    22. Monodelphis domestica mdo-miR-130c-3p
    23. Mus musculus mmu-miR-130a-3p
    24. Ophiophagus hannah (king cobra) oha-miR-130b-3p
    25. Ornithorhynchus anatinus (platypus) oan-miR-130b-3p
    26. Otolemur garnettii oga-miR-130a
    27. Ovis aries miscellaneous RNA
    28. Pan troglodytes ptr-miR-130a
    29. Pongo pygmaeus ppy-miR-130a
    30. Pteropus alecto pal-miR-130-3p
    31. Python bivittatus (Burmese python) pbv-miR-130d-3p
    32. Rattus norvegicus (Norway rat) rno-miR-130a-3p
    33. Sarcophilus harrisii Sha-Mir-130-P1b_3p (mature (guide))
    34. Sphenodon punctatus (tuatara) Spt-Mir-130-P1b_3p (mature (guide))
    35. Sus scrofa ssc-miR-130a
    36. Taeniopygia guttata tgu-miR-130c-3p
    37. Tor tambroides miR-130a
    38. Tupaia chinensis tch-miR-130a-3p
    39. Xenopus laevis Xla-Mir-130-P1b3_3p (mature (guide))
    40. Xenopus tropicalis xtr-miR-130a
    Publications New