v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-130b-3p URS0000315338_9258

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Ornithorhynchus anatinus. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Ornithorhynchus anatinus (platypus) oan-miR-130b-3p sequence is a product of miR-130b, MIR130B, miR-130b-3p, miR-130, oan-miR-130b, oan-miR-130b-3p genes. Found in the Ornithorhynchus anatinus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CAGUGCAAUGUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis Ami-Mir-130-P1b_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-130-P1b_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-130a
    4. Canis lupus familiaris cfa-miR-130a
    5. Capra hircus miR-130a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-130a-3p
    7. Cervus elaphus (red deer) cel-miR-130a
    8. Chrysemys picta bellii Cpi-Mir-130-P1b_3p (mature (guide))
    9. Columba livia cli-miR-130a-3p
    10. Cricetulus griseus cgr-miR-130a-3p
    11. Cyprinus carpio (common carp) ccr-miR-130a
    12. Danio rerio (zebrafish) dre-miR-130a
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130a-3p
    14. Echinops telfairi Ete-Mir-130-P1c_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-130a
    16. Gallus gallus gga-miR-130c-3p
    17. Gekko japonicus Gja-Mir-130-P1b_3p (mature (guide))
    18. Homo sapiens (human) hsa-miR-130a-3p
    19. Latimeria chalumnae Lch-Mir-130-P1b_3p (mature (guide))
    20. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P1b_3p (mature (co-guide))
    21. Macaca mulatta (Rhesus monkey) Mml-Mir-130-P1c_3p (mature (guide))
    22. Microcaecilia unicolor Mun-Mir-130-P1b_3p (mature (guide))
    23. Monodelphis domestica mdo-miR-130c-3p
    24. Mus musculus mmu-miR-130a-3p
    25. Ophiophagus hannah (king cobra) oha-miR-130b-3p
    26. Otolemur garnettii oga-miR-130a
    27. Ovis aries (sheep) miscellaneous RNA
    28. Pan troglodytes (chimpanzee) ptr-miR-130a
    29. Pongo pygmaeus ppy-miR-130a
    30. Pteropus alecto pal-miR-130-3p
    31. Python bivittatus pbv-miR-130d-3p
    32. Rattus norvegicus (Norway rat) rno-miR-130a-3p
    33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-130-P1b_3p (mature (guide))
    34. Sphenodon punctatus (tuatara) Spt-Mir-130-P1b_3p (mature (guide))
    35. Sus scrofa ssc-miR-130a
    36. Taeniopygia guttata (zebra finch) tgu-miR-130c-3p
    37. Tor tambroides miR-130a
    38. Tupaia chinensis (Chinese tree shrew) tch-miR-130a-3p
    39. Xenopus laevis Xla-Mir-130-P1b3_3p (mature (guide))
    40. Xenopus tropicalis xtr-miR-130a
     Publications