Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-130c-3p URS0000315338_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (MirGeneDB, RefSeq, ENA, miRBase). Gallus gallus (chicken) gga-miR-130c-3p sequence is a product of MIR-130c, gga-miR-130c, miR-130a, MIR130C, gga-miR-130c-3p, miR-130c, miR-130c-3p, 130, 130a, miR-130 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGUGCAAUGUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis Ami-Mir-130-P1b_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-130-P1b_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-130a
    4. Canis lupus familiaris (dog) cfa-miR-130a
    5. Capra hircus (goat) miR-130a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-130a-3p
    7. Cervus elaphus (red deer) cel-miR-130a
    8. Chrysemys picta bellii Cpi-Mir-130-P1b_3p (mature (guide))
    9. Columba livia (rock pigeon) cli-miR-130a-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-130a-3p
    11. Cyprinus carpio ccr-miR-130a
    12. Danio rerio (zebrafish) dre-miR-130a
    13. Dasypus novemcinctus dno-miR-130a-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P1c_3p (mature (guide))
    15. Equus caballus eca-miR-130a
    16. Gekko japonicus Gja-Mir-130-P1b_3p (mature (guide))
    17. Homo sapiens hsa-miR-130a-3p
    18. Latimeria chalumnae (coelacanth) Lch-Mir-130-P1b_3p (mature (guide))
    19. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P1b_3p (mature (co-guide))
    20. Macaca mulatta (Rhesus monkey) Mml-Mir-130-P1c_3p (mature (guide))
    21. Microcaecilia unicolor Mun-Mir-130-P1b_3p (mature (guide))
    22. Monodelphis domestica mdo-miR-130c-3p
    23. Mus musculus mmu-miR-130a-3p
    24. Ophiophagus hannah (king cobra) oha-miR-130b-3p
    25. Ornithorhynchus anatinus (platypus) oan-miR-130b-3p
    26. Otolemur garnettii oga-miR-130a
    27. Ovis aries miscellaneous RNA
    28. Pan troglodytes ptr-miR-130a
    29. Pongo pygmaeus ppy-miR-130a
    30. Pteropus alecto pal-miR-130-3p
    31. Python bivittatus (Burmese python) pbv-miR-130d-3p
    32. Rattus norvegicus (Norway rat) rno-miR-130a-3p
    33. Sarcophilus harrisii Sha-Mir-130-P1b_3p (mature (guide))
    34. Sphenodon punctatus (tuatara) Spt-Mir-130-P1b_3p (mature (guide))
    35. Sus scrofa ssc-miR-130a
    36. Taeniopygia guttata tgu-miR-130c-3p
    37. Tor tambroides miR-130a
    38. Tupaia chinensis tch-miR-130a-3p
    39. Xenopus laevis Xla-Mir-130-P1b3_3p (mature (guide))
    40. Xenopus tropicalis xtr-miR-130a
    Publications New