Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-130a-3p URS0000315338_246437

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tupaia chinensis. Annotated by 2 databases (RefSeq, miRBase). Tupaia chinensis (Chinese tree shrew) tch-miR-130a-3p sequence is a product of MIR130A, miR-130a-3p, tch-miR-130a, miR-130a, miR-130, tch-miR-130a-3p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGUGCAAUGUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis Ami-Mir-130-P1b_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-130-P1b_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-130a
    4. Canis lupus familiaris cfa-miR-130a
    5. Capra hircus miR-130a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-130a-3p
    7. Cervus elaphus (red deer) cel-miR-130a
    8. Chrysemys picta bellii Cpi-Mir-130-P1b_3p (mature (guide))
    9. Columba livia cli-miR-130a-3p
    10. Cricetulus griseus cgr-miR-130a-3p
    11. Cyprinus carpio (common carp) ccr-miR-130a
    12. Danio rerio (zebrafish) dre-miR-130a
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130a-3p
    14. Echinops telfairi Ete-Mir-130-P1c_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-130a
    16. Gallus gallus gga-miR-130c-3p
    17. Gekko japonicus Gja-Mir-130-P1b_3p (mature (guide))
    18. Homo sapiens (human) hsa-miR-130a-3p
    19. Latimeria chalumnae Lch-Mir-130-P1b_3p (mature (guide))
    20. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P1b_3p (mature (co-guide))
    21. Macaca mulatta (Rhesus monkey) Mml-Mir-130-P1c_3p (mature (guide))
    22. Microcaecilia unicolor Mun-Mir-130-P1b_3p (mature (guide))
    23. Monodelphis domestica mdo-miR-130c-3p
    24. Mus musculus mmu-miR-130a-3p
    25. Ophiophagus hannah (king cobra) oha-miR-130b-3p
    26. Ornithorhynchus anatinus (platypus) oan-miR-130b-3p
    27. Otolemur garnettii oga-miR-130a
    28. Ovis aries (sheep) miscellaneous RNA
    29. Pan troglodytes (chimpanzee) ptr-miR-130a
    30. Pongo pygmaeus ppy-miR-130a
    31. Pteropus alecto pal-miR-130-3p
    32. Python bivittatus pbv-miR-130d-3p
    33. Rattus norvegicus (Norway rat) rno-miR-130a-3p
    34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-130-P1b_3p (mature (guide))
    35. Sphenodon punctatus (tuatara) Spt-Mir-130-P1b_3p (mature (guide))
    36. Sus scrofa ssc-miR-130a
    37. Taeniopygia guttata (zebra finch) tgu-miR-130c-3p
    38. Tor tambroides miR-130a
    39. Xenopus laevis Xla-Mir-130-P1b3_3p (mature (guide))
    40. Xenopus tropicalis xtr-miR-130a
    Publications