Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-130a-3p URS0000315338_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, ENA, PirBase, LncBase, MirGeneDB, TarBase, miRBase). Described in 37 papers. Mus musculus (house mouse) mmu-miR-130a-3p sequence is a product of miR-130a-3p, miR-130, 130, mmu-miR-130a-3p, miR-130a, mmu-miR-130a, Mir130a genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610006A11Rik, 0610007H07Rik, 0610009F02Rik, 0610030G24Rik, 0610031P22Rik, 1110007I12Rik, 1110007L15Rik, 1110013J02Rik, 1110020D10Rik, 1110029L17Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGUGCAAUGUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Alligator mississippiensis Ami-Mir-130-P3a_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-130-P1a_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-130a
    4. Canis lupus familiaris cfa-miR-130a
    5. Capra hircus miR-130a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-130a-3p
    7. Cervus elaphus (red deer) cel-miR-130a
    8. Chrysemys picta bellii Cpi-Mir-130-P3a_3p (mature (guide))
    9. Columba livia (rock pigeon) cli-miR-130a-3p
    10. Cricetulus griseus cgr-miR-130a-3p
    11. Cyprinus carpio ccr-miR-130a
    12. Danio rerio (zebrafish) dre-miR-130a
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130a-3p
    14. Equus caballus (horse) eca-miR-130a
    15. Gallus gallus (chicken) gga-miR-130c-3p
    16. Homo sapiens hsa-miR-130a-3p
    17. Macaca mulatta Mml-Mir-130-P1a_3p (mature (guide))
    18. Monodelphis domestica mdo-miR-130c-3p
    19. Ophiophagus hannah oha-miR-130b-3p
    20. Ornithorhynchus anatinus oan-miR-130b-3p
    21. Otolemur garnettii oga-miR-130a
    22. Ovis aries miscellaneous RNA
    23. Pan troglodytes (chimpanzee) ptr-miR-130a
    24. Pongo pygmaeus ppy-miR-130a
    25. Pteropus alecto pal-miR-130-3p
    26. Python bivittatus pbv-miR-130d-3p
    27. Rattus norvegicus rno-miR-130a-3p
    28. Sarcophilus harrisii Sha-Mir-130-P3a_3p (mature (guide))
    29. Sus scrofa ssc-miR-130a
    30. Taeniopygia guttata (zebra finch) tgu-miR-130c-3p
    31. Tor tambroides miR-130a
    32. Tupaia chinensis tch-miR-130a-3p
    33. Xenopus laevis (African clawed frog) xla-miR-130a
    34. Xenopus tropicalis xtr-miR-130a