Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 61 (SNORD61) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 61 (SNORD61) URS0000313FF1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD61: SNORD61 is one of the candidate genes that were tested in a study [PMC7267729]. The study aimed to select normalizing genes based on PCR efficiency and the Thermo Fisher cloud application score [PMC7267729]. The primer used for SNORD61 in the study was Hs-SNORD61-11 miScript Primer Assay [PMC7203836]. SNORD61 was included in a miRNA qPCR array along with other endogenous controls such as SNORD68, SNORD72, SNORD95, and RNU6-2 for normalization of miRNA expression [PMC10152154]. The other candidate genes tested were Rnu6-2, Snord68, and Snord70 [PMC7267729]. However, Rnu6-2 and SNORD61 were selected as the normalizing genes based on their performance in PCR efficiency and Thermo Fisher cloud application score [PMC7267729]. The primer used for miR-125-b-2-3p was Rn-miR-125b*-2 miScript Primer Assay [PMC7203836]. These findings suggest that SNORD61 is a potential normalizing gene for gene expression studies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUAUGAUGAAUUUGAUUGCAUUGAUCGUCUGACAUGAUAAUGUAUUUUUGUCCUCUAAGAAGUUCUGAGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications