Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FGF12 antisense RNA 2 (FGF12-AS2) URS0000313F54_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FGF12-AS2: FGF12-AS2 is a long non-coding RNA (lncRNA) that has been identified in a study along with eight other lncRNAs, two miRNAs, and three mRNAs [PMC9071875]. The study aimed to investigate the impact of FGF12-AS2 on the epithelial-mesenchymal transition (EMT) process in non-small cell lung cancer (NSCLC) [PMC7724005].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCGGAGGCGGUGGCUGGUCUGAGGACGACGCGGAGGACGUCACUGCGGGUCGGUGCUUCCUUACAGGUGCCUUCUGGACCGGGGUCCUUGGCACCUCCCCUGCUCCUGCCCUCGGUGCCGGACCCUGUGCCCUGGGAGCCCGACUACCUCGGUGUCCCAGCCGUCCCGGGCUUGAGGCGCUGAGAGGGCUGCGCGGCUUCCAGCCCGGAAGGCAGCGGUCCCGCGGGCUGCGCGCGGCCAAGGGCGACUCCGGUGUGGGAAUCCGGCGGAAGGGAAGCACCCGCAGGGAGGGCUGGACCCCGGAGGCUGCAGAGCGUCAGAAGCGACUCUAGGGAACUAGGGGGUGGGGUAGGGAGGCGGGGACGUGGAAUAAAGAAAGCUCCUGGGUGCCGGCUAUGAGAAGUCAGGUGUGCGUAGGCGUGGACAGAGUGCCGAUGUGGGAGUCUGGACACCUGGAUUUUCUGGUCGGGGCUCUGUGUCCUUGGGCUAAACAUUCGCGGUUCCACUGGCUCCCUAACACUUGAAAUGAUGUUUGAAGUUGCCUGGAAGAAGUCUCUUCCUUUUUUCUCUCAGAGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications