Macaca mulatta (Rhesus monkey) mml-miR-875-5p URS0000312ECD_9544

• 22 nucleotides
• 3 databases (miRBase, MirGeneDB, RefSeq)
• Found in 9 other species
• 6 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAUACCUCAGUUUUAUCAGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

1. Bos taurus (cattle) bta-miR-875
2. Callithrix jacchus cja-miR-875-5p
3. Canis lupus familiaris cfa-miR-875
4. Homo sapiens hsa-miR-875-5p
5. Mus musculus (house mouse) mmu-miR-875-5p
6. Oryctolagus cuniculus ocu-miR-875-5p
7. Pan troglodytes ptr-miR-875
8. Pongo pygmaeus (Bornean orangutan) ppy-miR-875-5p
9. Rattus norvegicus (Norway rat) rno-miR-875

Publications Download

• FASTA
• JSON