Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000312DD7_559292

Automated summary: This snoRNA sequence is 90 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, IntAct, RefSeq, SGD). Described in 37 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR50, RF01190). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR50 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11792852 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-16632034 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAGAAUGAUGAAAGAGGUAGCAAUUUGCAGCAGAUUUUUCGUGAUUGAAUCAAACAAAGAUUAACCUUUACAGAACCGCUACACUGAUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 95 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR50
    2. Saccharomyces cerevisiae EC1118 SNR50
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR50
    4. Saccharomyces cerevisiae P283 SNR50
    5. Saccharomyces cerevisiae P301 SNR50
    6. Saccharomyces cerevisiae PE-2 SNR50
    7. Saccharomyces cerevisiae R008 SNR50
    8. Saccharomyces cerevisiae R103 SNR50
    9. Saccharomyces cerevisiae YJM1078 SNR50
    10. Saccharomyces cerevisiae YJM1083 SNR50
    11. Saccharomyces cerevisiae YJM1129 SNR50
    12. Saccharomyces cerevisiae YJM1133 SNR50
    13. Saccharomyces cerevisiae YJM1190 SNR50
    14. Saccharomyces cerevisiae YJM1199 SNR50
    15. Saccharomyces cerevisiae YJM1202 SNR50
    16. Saccharomyces cerevisiae YJM1208 SNR50
    17. Saccharomyces cerevisiae YJM1242 SNR50
    18. Saccharomyces cerevisiae YJM1244 SNR50
    19. Saccharomyces cerevisiae YJM1248 SNR50
    20. Saccharomyces cerevisiae YJM1250 SNR50
    21. Saccharomyces cerevisiae YJM1252 SNR50
    22. Saccharomyces cerevisiae YJM1273 SNR50
    23. Saccharomyces cerevisiae YJM1304 SNR50
    24. Saccharomyces cerevisiae YJM1307 SNR50
    25. Saccharomyces cerevisiae YJM1311 SNR50
    26. Saccharomyces cerevisiae YJM1326 SNR50
    27. Saccharomyces cerevisiae YJM1332 SNR50
    28. Saccharomyces cerevisiae YJM1336 SNR50
    29. Saccharomyces cerevisiae YJM1338 SNR50
    30. Saccharomyces cerevisiae YJM1341 SNR50
    31. Saccharomyces cerevisiae YJM1342 SNR50
    32. Saccharomyces cerevisiae YJM1355 SNR50
    33. Saccharomyces cerevisiae YJM1356 SNR50
    34. Saccharomyces cerevisiae YJM1381 SNR50
    35. Saccharomyces cerevisiae YJM1383 SNR50
    36. Saccharomyces cerevisiae YJM1385 SNR50
    37. Saccharomyces cerevisiae YJM1386 SNR50
    38. Saccharomyces cerevisiae YJM1387 SNR50
    39. Saccharomyces cerevisiae YJM1388 SNR50
    40. Saccharomyces cerevisiae YJM1389 SNR50
    41. Saccharomyces cerevisiae YJM1399 SNR50
    42. Saccharomyces cerevisiae YJM1400 SNR50
    43. Saccharomyces cerevisiae YJM1401 SNR50
    44. Saccharomyces cerevisiae YJM1402 SNR50
    45. Saccharomyces cerevisiae YJM1415 SNR50
    46. Saccharomyces cerevisiae YJM1417 SNR50
    47. Saccharomyces cerevisiae YJM1433 SNR50
    48. Saccharomyces cerevisiae YJM1434 SNR50
    49. Saccharomyces cerevisiae YJM1439 SNR50
    50. Saccharomyces cerevisiae YJM1443 SNR50
    51. Saccharomyces cerevisiae YJM1447 SNR50
    52. Saccharomyces cerevisiae YJM1450 SNR50
    53. Saccharomyces cerevisiae YJM1460 SNR50
    54. Saccharomyces cerevisiae YJM1463 SNR50
    55. Saccharomyces cerevisiae YJM1477 SNR50
    56. Saccharomyces cerevisiae YJM1478 SNR50
    57. Saccharomyces cerevisiae YJM1479 SNR50
    58. Saccharomyces cerevisiae YJM1526 SNR50
    59. Saccharomyces cerevisiae YJM1527 SNR50
    60. Saccharomyces cerevisiae YJM1549 SNR50
    61. Saccharomyces cerevisiae YJM1573 SNR50
    62. Saccharomyces cerevisiae YJM1574 SNR50
    63. Saccharomyces cerevisiae YJM1592 SNR50
    64. Saccharomyces cerevisiae YJM1615 SNR50
    65. Saccharomyces cerevisiae YJM189 SNR50
    66. Saccharomyces cerevisiae YJM193 SNR50
    67. Saccharomyces cerevisiae YJM195 SNR50
    68. Saccharomyces cerevisiae YJM244 SNR50
    69. Saccharomyces cerevisiae YJM248 SNR50
    70. Saccharomyces cerevisiae YJM270 SNR50
    71. Saccharomyces cerevisiae YJM271 SNR50
    72. Saccharomyces cerevisiae YJM320 SNR50
    73. Saccharomyces cerevisiae YJM326 SNR50
    74. Saccharomyces cerevisiae YJM428 SNR50
    75. Saccharomyces cerevisiae YJM451 SNR50
    76. Saccharomyces cerevisiae YJM453 SNR50
    77. Saccharomyces cerevisiae YJM456 SNR50
    78. Saccharomyces cerevisiae YJM470 SNR50
    79. Saccharomyces cerevisiae YJM541 SNR50
    80. Saccharomyces cerevisiae YJM554 SNR50
    81. Saccharomyces cerevisiae YJM627 SNR50
    82. Saccharomyces cerevisiae YJM682 SNR50
    83. Saccharomyces cerevisiae YJM683 SNR50
    84. Saccharomyces cerevisiae YJM689 SNR50
    85. Saccharomyces cerevisiae YJM693 SNR50
    86. Saccharomyces cerevisiae YJM969 SNR50
    87. Saccharomyces cerevisiae YJM972 SNR50
    88. Saccharomyces cerevisiae YJM975 SNR50
    89. Saccharomyces cerevisiae YJM978 SNR50
    90. Saccharomyces cerevisiae YJM981 SNR50
    91. Saccharomyces cerevisiae YJM984 SNR50
    92. Saccharomyces cerevisiae YJM987 SNR50
    93. Saccharomyces cerevisiae YJM990 SNR50
    94. Saccharomyces cerevisiae YJM993 SNR50
    95. Saccharomyces cerevisiae YJM996 SNR50
    2D structure New