Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila erecta der-miR-4 URS000030D462_7220

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAAGCUAGACAACCAUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Drosophila ananassae dan-miR-4
  2. Drosophila grimshawi dgr-miR-4
  3. Drosophila melanogaster (fruit fly) dme-miR-4-3p
  4. Drosophila mojavensis dmo-miR-4
  5. Drosophila persimilis dpe-miR-4
  6. Drosophila pseudoobscura dps-miR-4
  7. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294429_df_nrg
  8. Drosophila sechellia dse-miR-4
  9. Drosophila simulans dsi-miR-4
  10. Drosophila virilis dvi-miR-4-3p
  11. Drosophila willistoni dwi-miR-4
  12. Drosophila yakuba dya-miR-4