Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-4-3p URS000030D462_7227

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (RefSeq, ENA, miRBase, FlyBase). Described in 13 papers. Drosophila melanogaster (fruit fly) dme-miR-4-3p sequence is a product of 4-R, miR-4-3p, mir-4, miR-4, dme-miR-4, dme-miR-4-3p, 4-RA, FBgn0262414, mir-4-RA genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAAAGCUAGACAACCAUUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 59 other species

    1. Drosophila ananassae dan-miR-4
    2. Drosophila erecta der-miR-4
    3. Drosophila grimshawi dgr-miR-4
    4. Drosophila mojavensis dmo-miR-4
    5. Drosophila persimilis dpe-miR-4
    6. Drosophila pseudoobscura dps-miR-4
    7. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294429_df_nrg
    8. Drosophila sechellia dse-miR-4
    9. Drosophila simulans dsi-miR-4
    10. Drosophila virilis dvi-miR-4-3p
    11. Drosophila willistoni dwi-miR-4
    12. Drosophila yakuba dya-miR-4
    Publications New