v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-34a URS000030BD69_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 3 databases (ENA, RefSeq, miRBase). Danio rerio (zebrafish) dre-miR-34a sequence is a product of miR-34a, mir34a, dre-miR-34a, miR-34 genes. Found in the Danio rerio reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGGCAGUGUCUUAGCUGGUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Anolis carolinensis Aca-Mir-34-P1_5p (mature (guide))
    2. Ateles geoffroyi age-miR-34a
    3. Bos taurus (cattle) bta-miR-34a
    4. Callorhinchus milii (elephant shark) eshark_mir-34_3
    5. Canis lupus familiaris cfa-miR-34a
    6. Capra hircus chi-miR-34a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-34a-5p
    8. Chiloscyllium plagiosum microRNA cpl-miR-34a
    9. Chrysemys picta bellii Cpi-Mir-34-P1_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-34a-5p
    11. Columba livia cli-miR-34a-5p
    12. Cricetulus griseus cgr-miR-34a
    13. Cyprinus carpio (common carp) ccr-miR-34
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34a-5p
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-34-P1_5p (mature (guide))
    16. Equus caballus (horse) eca-miR-34a
    17. Gadus morhua (Atlantic cod) gmo-miR-34-5p
    18. Gallus gallus (chicken) Gga-Mir-34-P1_5p (mature (guide))
    19. Gorilla gorilla ggo-miR-34a
    20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-34
    21. Homo sapiens (human) hsa-miR-34a-5p
    22. Ictalurus punctatus ipu-miR-34a
    23. Lagothrix lagotricha (brown woolly monkey) lla-miR-34a
    24. Macaca mulatta (Rhesus monkey) mml-miR-34a-5p
    25. Macaca nemestrina (pig-tailed macaque) mne-miR-34a
    26. Maylandia zebra (zebra mbuna) mze-miR-34
    27. Microcebus murinus (gray mouse lemur) mmr-miR-34a
    28. Mus musculus mmu-miR-34a-5p
    29. Neolamprologus brichardi nbr-miR-34
    30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-34a
    31. Oreochromis niloticus oni-miR-34
    32. Oryctolagus cuniculus ocu-miR-34a-5p
    33. Otolemur garnettii oga-miR-34a
    34. Pan paniscus ppa-miR-34a
    35. Pan troglodytes (chimpanzee) ptr-miR-34a
    36. Pongo pygmaeus ppy-miR-34a
    37. Pteropus alecto pal-miR-34a-5p
    38. Pundamilia nyererei pny-miR-34
    39. Python bivittatus pbv-miR-34a-5p
    40. Rattus norvegicus (Norway rat) rno-miR-34a-5p
    41. Saguinus labiatus (red-chested mustached tamarin) sla-miR-34a
    42. Sus scrofa ssc-miR-34a
    43. synthetic construct miscellaneous RNA
    44. Taeniopygia guttata (zebra finch) tgu-miR-34a
    45. Tetraodon nigroviridis Tni-Mir-34-P1_5p (mature (guide))
    46. Tor tambroides miR-34a
    47. Xenopus laevis xla-miR-34a
    48. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4079397
     Publications