Tupaia chinensis (Chinese tree shrew) tch-miR-29c-3p URS000030B2CE_246437

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 12 other species
• 133 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGCACCAUUUGAAAUCGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Anolis carolinensis (green anole) aca-miR-29a-3p
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-29c
3. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2a-v1_3p (mature (guide))
4. Cricetulus griseus (Chinese hamster) cgr-miR-29c-3p
5. Gallus gallus gga-miR-29a-3p
6. Monodelphis domestica mdo-miR-29a-3p
7. Mus musculus Mus_musculus piRNA piR-mmu-8189236
8. Ornithorhynchus anatinus (platypus) oan-miR-29a-3p
9. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63151
10. Taeniopygia guttata (zebra finch) tgu-miR-29a-3p
11. Tursiops truncatus miR-29c
12. Xenopus tropicalis xtr-miR-29a

Publications Download

• FASTA
• JSON