Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata aly-miR166g-3p URS00003065B2_59689

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Arabidopsis lyrata. Annotated by 2 databases (ENA, miRBase). Described in 1 paper. Arabidopsis lyrata aly-miR166g-3p sequence is a product of miR166b, miR166e, miR166g-3p, aly-miR166b-3p, aly-miR166d, miR166, aly-miR166c-3p, aly-miR166a-3p, aly-miR166a, miR166a-3p, miR166f-3p, miR166h, miR166g, aly-miR166f, miR166f, aly-miR166d-3p, miR166d-3p, aly-miR166c, miR166c, miR166h-3p, aly-miR166e, aly-miR166f-3p, aly-miR166g-3p, miR166a, aly-miR166h, aly-miR166g, miR166d, miR166b-3p, aly-miR166b, aly-miR166e-3p, miR166e-3p, miR166c-3p, aly-miR166h-3p genes. Found in the Arabidopsis lyrata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGGACCAGGCUUCAUUCCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 94 other species

    1. Aegilops tauschii ata-miR166e-3p
    2. Amborella trichopoda atr-miR166a
    3. Ananas comosus microRNA 166b
    4. Aquilegia coerulea aqc-miR166b
    5. Arabidopsis thaliana ath-miR166e-3p
    6. Asparagus officinalis aof-miR166d
    7. Brachypodium distachyon (stiff brome) bdi-miR166c-3p
    8. Brassica napus bna-miR166e
    9. Carica papaya (papaya) cpa-miR166a
    10. Citrus sinensis (sweet orange) csi-miR166e-3p
    11. Cucumis melo (muskmelon) cme-miR166b
    12. Cynara cardunculus var. scolymus cca-miR166b
    13. Digitalis purpurea dpr-miR166b
    14. Eugenia uniflora eun-miR166-3p
    15. Fragaria vesca subsp. vesca fve-miR166a
    16. Glycine max (soybean) gma-miR166i-3p
    17. Gossypium hirsutum ghr-miR166b
    18. Helianthus annuus sRNA HannXRQ_Chr03g0086145
    19. Helianthus paradoxus hpa-miR166a
    20. Helianthus petiolaris hpe-miR166a
    21. Hordeum vulgare hvu-miR166b
    22. Hypericum perforatum Hyp-miR166
    23. Linum usitatissimum (flax) lus-miR166d
    24. Malus domestica (apple) mdm-miR166f
    25. Manihot esculenta (cassava) mes-miR166b
    26. Medicago truncatula mtr-miR166g-3p
    27. Musa AAB Group miR166
    28. Mus musculus Mus_musculus piRNA piR-mmu-50191420
    29. Nicotiana attenuata microRNA mir-166-like
    30. Nicotiana tabacum (common tobacco) nta-miR166g
    31. Oryza sativa Japonica Group microRNA osa-miR166b-3p
    32. Oryza sativa (rice) osa-miR166c-3p
    33. Pachycladon cheesemanii Pch-miR166a
    34. Pachycladon fastigiatum Pfa-miR166a
    35. Phaseolus vulgaris pvu-miR166a
    36. Physcomitrium patens ppt-miR166d
    37. Picea abies (Norway spruce) pab-miR166g
    38. Pinus taeda pta-miR166a
    39. Populus tomentosa Pto-miR166h
    40. Populus trichocarpa (black cottonwood) ptc-miR166i
    41. Prunus persica ppe-miR166d
    42. Ricinus communis rco-miR166b
    43. Rosa chinensis ath-miR166a-3p
    44. Saccharum sp. ssp-miR166
    45. Salvia sclarea ssl-miR166b
    46. Selaginella moellendorffii smo-miR166a
    47. Solanum lycopersicum (tomato) sly-miR166a
    48. Solanum tuberosum (potato) stu-miR166a-3p
    49. Theobroma cacao tcc-miR166a
    50. Vitis vinifera vvi-miR166g
    51. Vriesea carinata vca-miR166b-3p
    52. Zea mays zma-miR166a-3p