Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR166a-3p URS00003065B2_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (ENA, RefSeq, miRBase). Described in 6 papers. Zea mays zma-miR166a-3p sequence is a product of miR166, zma-miR166a-3p, MIR166a, miR166a-3p, zma-miR166a, miR166a genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGGACCAGGCUUCAUUCCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Aegilops tauschii ata-miR166e-3p
    2. Amborella trichopoda atr-miR166d
    3. Ananas comosus microRNA 166b
    4. Aquilegia coerulea aqc-miR166e
    5. Arabidopsis lyrata aly-miR166h-3p
    6. Arabidopsis thaliana ath-miR166a-3p
    7. Asparagus officinalis aof-miR166d
    8. Brachypodium distachyon (stiff brome) bdi-miR166d-3p
    9. Brassica napus (rape) bna-miR166b
    10. Carica papaya (papaya) cpa-miR166a
    11. Citrus sinensis (sweet orange) csi-miR166e-3p
    12. Cucumis melo (muskmelon) cme-miR166d
    13. Cynara cardunculus var. scolymus cca-miR166b
    14. Digitalis purpurea (common foxglove) dpr-miR166b
    15. Eugenia uniflora eun-miR166-3p
    16. Fragaria vesca subsp. vesca fve-miR166d-3p
    17. Glycine max (soybean) gma-miR166o
    18. Gossypium hirsutum ghr-miR166b
    19. Helianthus annuus sRNA HannXRQ_Chr03g0086145
    20. Helianthus paradoxus hpa-miR166a
    21. Helianthus petiolaris hpe-miR166a
    22. Hordeum vulgare hvu-miR166c
    23. Hypericum perforatum Hyp-miR166
    24. Linum usitatissimum (flax) lus-miR166g
    25. Malus domestica (apple) mdm-miR166d
    26. Manihot esculenta (cassava) mes-miR166c
    27. Medicago truncatula mtr-miR166a
    28. Musa AAB Group miR166
    29. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50191420
    30. Nicotiana attenuata microRNA mir-166-like
    31. Nicotiana tabacum nta-miR166f
    32. Oryza sativa Japonica Group microRNA osa-miR166b-3p
    33. Oryza sativa (rice) osa-miR166b-3p
    34. Pachycladon cheesemanii Pch-miR166a
    35. Pachycladon fastigiatum Pfa-miR166a
    36. Phaseolus vulgaris pvu-miR166a
    37. Physcomitrium patens ppt-miR166f
    38. Picea abies (Norway spruce) pab-miR166h
    39. Pinus taeda (loblolly pine) pta-miR166a
    40. Populus tomentosa Pto-miR166h
    41. Populus trichocarpa ptc-miR166g
    42. Prunus persica ppe-miR166d
    43. Ricinus communis rco-miR166c
    44. Rosa chinensis ath-miR166a-3p
    45. Saccharum sp. ssp-miR166
    46. Salvia sclarea (clary) ssl-miR166b
    47. Selaginella moellendorffii smo-miR166c
    48. Solanum lycopersicum (tomato) sly-miR166a
    49. Solanum tuberosum (potato) stu-miR166a-3p
    50. Theobroma cacao (cacao) tcc-miR166d
    51. Vitis vinifera vvi-miR166f
    52. Vriesea carinata vca-miR166c-3p