Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR166d-3p URS00003065B2_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR166a-3p: Osa-mir166a-3p is a microRNA that has been studied in various contexts. It is one of the highly expressed miRNAs, with more than 10,000 reads in five different lines [PMC5578646]. It has also been detected along with other known miRNAs, such as osa-mir166a-5p and osa-mir166b-5p [PMC6337123]. Osa-mir166a-3p has been found to be involved in low-light-mediated signaling mechanisms, as shown through expression analysis and validation using qRT-PCR [PMC9614602]. Its expression pattern has been observed to be upregulated in tolerant genotypes and downregulated in sensitive genotypes of rice [PMC9614602]. Osa-mir166a-3p has a negative correlation with the expression of its target gene rolled leaf1, indicating its role in suppressing the expression of rolled leaf1 through cleavage [PMC9614602]. In other studies, osa-mir166a-3p was found to be downregulated in O. alta and O. latifolia, while upregulated in O. officinalis [PMC7662745]. It is also one of the most abundantly expressed conserved miRNAs in DXWR [PMC9960954]. Furthermore, osa-mir166a-3p targets members of the OsHDZIP subfamily III along with other miRNA families [PMC9405480]. qRT-PCR analysis confirmed similar expression patterns for osa-miR156a-5p, osa-mir166a-3p, and osamiR167-a5-p as observed through sequencing data [PMC4203131].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Aegilops tauschii ata-miR166d-3p
  2. Amborella trichopoda atr-miR166d
  3. Ananas comosus microRNA 166b
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR166e
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR166d-3p
  6. Arabidopsis thaliana ath-miR166b-3p
  7. Asparagus officinalis aof-miR166d
  8. Brachypodium distachyon bdi-miR166d-3p
  9. Brassica napus (rape) bna-miR166c
  10. Carica papaya (papaya) cpa-miR166c
  11. Citrus sinensis (sweet orange) csi-miR166e-3p
  12. Cucumis melo cme-miR166d
  13. Cynara cardunculus var. scolymus cca-miR166b
  14. Digitalis purpurea dpr-miR166b
  15. Eugenia uniflora (Brazil-cherry) eun-miR166-3p
  16. Fragaria vesca subsp. vesca fve-miR166e
  17. Glycine max (soybean) gma-miR166b
  18. Gossypium hirsutum ghr-miR166b
  19. Helianthus annuus ath-miR166a-3p
  20. Helianthus paradoxus hpa-miR166a
  21. Helianthus petiolaris hpe-miR166a
  22. Hordeum vulgare (barley) hvu-miR166a
  23. Hypericum perforatum Hyp-miR166
  24. Linum usitatissimum (flax) lus-miR166j
  25. Malus domestica mdm-miR166f
  26. Manihot esculenta mes-miR166d
  27. Medicago truncatula (barrel medic) mtr-miR166g-3p
  28. Musa AAB Group miR166
  29. Mus musculus Mus_musculus piRNA piR-mmu-50191420
  30. Nicotiana attenuata microRNA mir-166-like
  31. Nicotiana tabacum nta-miR166f
  32. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166b-3p
  33. Pachycladon cheesemanii Pch-miR166a
  34. Pachycladon fastigiatum Pfa-miR166a
  35. Phaseolus vulgaris (string bean) pvu-miR166a
  36. Physcomitrium patens ppt-miR166g
  37. Picea abies pab-miR166h
  38. Pinus taeda pta-miR166b
  39. Populus tomentosa Pto-miR166h
  40. Populus trichocarpa (black cottonwood) ptc-miR166g
  41. Prunus persica (peach) ppe-miR166a
  42. Ricinus communis rco-miR166e
  43. Rosa chinensis ath-miR166a-3p
  44. Saccharum sp. ssp-miR166
  45. Salvia sclarea ssl-miR166b
  46. Selaginella moellendorffii smo-miR166c
  47. Solanum lycopersicum (tomato) sly-miR166b
  48. Solanum tuberosum stu-miR166a-3p
  49. Theobroma cacao tcc-miR166a
  50. Vitis vinifera (wine grape) vvi-miR166f
  51. Vriesea carinata vca-miR166c-3p
  52. Zea mays (maize) zma-miR166a-3p
Publications