Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166b-3p URS00003065B2_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166b-3p sequence is a product of miR166c, miR166d, miR166j-3p, osa-miR166c-3p, osa-miR166j-3p, osa-miR166j, miR166j, miR166f, osa-miR166c, osa-miR166f, osa-miR166b, miR166a-3p, osa-miR166b-3p, miR166b-3p, miR166, miR166a, osa-miR166d-3p, miR166b, osa-miR166d, osa-miR166a, miR166d-3p, osa-miR166a-3p, miR166c-3p genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCGGACCAGGCUUCAUUCCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 654 other species

    1. Aegilops tauschii ata-miR166d-3p
    2. Amborella trichopoda atr-miR166c
    3. Ananas comosus (pineapple) microRNA 166b
    4. Aquilegia coerulea aqc-miR166b
    5. Arabidopsis lyrata aly-miR166d-3p
    6. Arabidopsis thaliana (thale cress) ath-miR166f
    7. Asparagus officinalis (garden asparagus) aof-miR166d
    8. Brachypodium distachyon (stiff brome) bdi-miR166d-3p
    9. Brassica napus bna-miR166b
    10. Carica papaya (papaya) cpa-miR166a
    11. Citrus sinensis (sweet orange) csi-miR166e-3p
    12. Cucumis melo cme-miR166d
    13. Cynara cardunculus var. scolymus cca-miR166b
    14. Digitalis purpurea dpr-miR166b
    15. Eugenia uniflora eun-miR166-3p
    16. Fragaria vesca subsp. vesca fve-miR166b
    17. Glycine max (soybean) gma-miR166c-3p
    18. Gossypium hirsutum ghr-miR166b
    19. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr03g0086145
    20. Helianthus paradoxus hpa-miR166a
    21. Helianthus petiolaris hpe-miR166a
    22. Hordeum vulgare hvu-miR166a
    23. Hypericum perforatum Hyp-miR166
    24. Linum usitatissimum (flax) lus-miR166d
    25. Malus domestica (apple) mdm-miR166h
    26. Manihot esculenta (cassava) mes-miR166f
    27. Medicago truncatula mtr-miR166a
    28. Musa AAB Group miR166
    29. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50191420
    30. Nicotiana attenuata microRNA mir-166-like
    31. Nicotiana tabacum (common tobacco) nta-miR166h
    32. Oryza sativa osa-miR166b-3p
    33. Pachycladon cheesemanii Pch-miR166a
    34. Pachycladon fastigiatum Pfa-miR166a
    35. Phaseolus vulgaris pvu-miR166a
    36. Physcomitrium patens ppt-miR166b
    37. Picea abies pab-miR166i
    38. Pinus taeda (loblolly pine) pta-miR166b
    39. Populus tomentosa Pto-miR166h
    40. Populus trichocarpa (black cottonwood) ptc-miR166i
    41. Prunus persica (peach) ppe-miR166c
    42. Ricinus communis (castor bean) rco-miR166d
    43. Rosa chinensis ath-miR166a-3p
    44. Saccharum sp. ssp-miR166
    45. Salvia sclarea (clary) ssl-miR166b
    46. Selaginella moellendorffii smo-miR166c
    47. Solanum lycopersicum sly-miR166b
    48. Solanum tuberosum (potato) stu-miR166c-3p
    49. Theobroma cacao tcc-miR166d
    50. Vitis vinifera (wine grape) vvi-miR166f
    51. Vriesea carinata vca-miR166c-3p
    52. Zea mays zma-miR166a-3p