Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis suecica mir-395 URS00003027F6_45249

Automated summary: This pre miRNA sequence is 93 nucleotides long and is found in Arabidopsis suecica. Annotated by 1 database (ENA). Described in 0 papers. Matches 1 Rfam family (mir-395, RF00451). Arabidopsis suecica mir-395 sequence is a product of 395, mir-395 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGUCUCCUAGAGUUCCUCUGAGCACUUCAUUGGGGAUACAAUUUUUCUAAAUGAUUAUCCACUGAAGUGUUUGGGGGAACUCCCGGACCCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Arabidopsis thaliana miR395a stem-loop (ath-MIR395a)
    2. Arabidopsis thaliana x Arabidopsis arenosa mir-395