Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-17-5p URS00002FDD5B_9031

Automated summary: This miRNA sequence is 24 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (RefSeq, miRBase, PirBase, ENA). Described in 6 papers. Gallus gallus (chicken) gga-miR-17-5p sequence is a product of miR-17, MIR17, gga-miR-17, miR-17-5p, gga-miR-17-5p genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAAAGUGCUUACAGUGCAGGUAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-17-5p
    2. Bos taurus (cattle) bta-miR-17-5p
    3. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-425677
    4. Capra hircus chi-miR-17-5p
    5. Drosophila erecta Drosophila_erecta piRNA piR-der-149061
    6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21097546
    7. Gorilla gorilla (western gorilla) ggo-miR-17-5p
    8. Homo sapiens microRNA miR-91
    9. Lagothrix lagotricha lla-miR-17-5p
    10. Lemur catta lca-miR-17-5p
    11. Macaca mulatta mml-miR-17-5p
    12. Macaca nemestrina (pig-tailed macaque) mne-miR-17-5p
    13. Monodelphis domestica mdo-miR-17-5p
    14. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72410
    15. Ophiophagus hannah oha-miR-17-5p
    16. Oryctolagus cuniculus (rabbit) Oryctolagus_cuniculus piRNA piR-ocu-114588
    17. Ovis aries miscellaneous RNA
    18. Pan paniscus ppa-miR-17-5p
    19. Pan troglodytes (chimpanzee) ptr-miR-17-5p
    20. Pongo pygmaeus ppy-miR-17-5p
    21. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62952
    22. Saguinus labiatus sla-miR-17-5p
    23. Xenopus laevis (African clawed frog) xla-miR-17-5p
    24. Xenopus tropicalis xtr-miR-17-5p