Oryza sativa (Asian cultivated rice) osa-miR167e-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR167e-3p URS00002FDBAB_4530

21 nucleotides
1 database (miRBase)
Found in 1 other species
7 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR167e-3p: Osa-mir167e-3p is a heat-responsive miRNA that targets HSF or HSP genes to modulate gene expression [PMC9136941]. It is among the twenty-six miRNAs that exhibit preferential expression in fungal-infected resistant genotypes [PMC7662745]. Additionally, osa-mir167e-3p is up-regulated in rice leaves during grain-filling stages [PMC4257594]. It plays a specific role in response to heat priming, along with osa-miR531a, osa-miR5149, osa-miR168a-5p, osa-miR1846d-5p, and osa-miR5077 [PMC8067039].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGAUCAUGUUGCAGCUUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167e-3p

Publications