Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-671 URS00002FB368_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-671: Bta-mir-671 is a differentially expressed miRNA that was found to be up-regulated in the liver of steers [PMC8993808]. This finding was confirmed through RT-qPCR [PMC8993808]. In addition to bta-mir-671, other miRNAs such as bta-miR-365-3p, bta-miR-122, bta-miR-200c, bta-miR-374b, and bta-miR-15a were also up-regulated in the liver of steers [PMC8993808]. These miRNAs were found to be related to lipid metabolism [PMC8993808]. Another study reported the expression of bta-mir-671 and bta-miR-1306 but did not investigate their regulatory roles [PMC10000098]. Furthermore, a Venn diagram analysis revealed that bta-mir-671 was differentially expressed in the ARM_SCM comparison and was one of the nine differentially expressed miRNAs in this comparison [PMC10000098]. Bta-mir-671 was also found to target TLR4 and IFNγ, both of which are involved in macrophage activation [PMC8578396]. Overall, these findings suggest that bta-mir-671 may play a significant role in lipid metabolism and macrophage activation through its regulatory effects on target genes such as TLR4 and IFNγ. However, further research is needed to fully understand the functional significance of this miRNA.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAGCCCUGGAGGGGCUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications