v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-let-7f-3p URS00002F8148_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-let-7f: Gga-let-7f is a miRNA that is dominantly expressed in breast muscle libraries and is part of the let-7 family of miRNAs [PMC3700833]. It is one of the top 20 abundant miRNAs in breast muscle libraries [PMC4519947]. In a study comparing the expression of miRNAs in VVs, gga-let-7f was found to be expressed along with other miRNAs such as gga-miR-92-3p, gga-miR-22-5p, and gga-miR-26a-5p [PMC10014936]. In the ovary, gga-let-7f was found to be down-regulated compared to the testis [PMC3526641]. In a comparison between different conditions and lines, gga-let 7f was one of only two miRNAs that were found to be differentially abundant [PMC4256448]. The expression levels of gga-miR 2188 5p, gga let 7f -5p, and other miRNAs were also found to vary in plasma samples [PMC4256448].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUAUACAAUCUAUUGCCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Capra hircus (goat) chi-let-7f-3p
  2. Cavia porcellus cpo-let-7f-3p
  3. Columba livia cli-let-7f-3p
  4. Dasypus novemcinctus dno-let-7f-3p
  5. Homo sapiens hsa-let-7f-1-3p
  6. Macaca mulatta (Rhesus monkey) mml-let-7f-3p
  7. Monodelphis domestica (gray short-tailed opossum) mdo-let-7f-1-3p
  8. Mus musculus mmu-let-7f-1-3p
  9. Ophiophagus hannah (king cobra) oha-let-7f-2-3p
  10. Oryctolagus cuniculus (rabbit) ocu-let-7f-3p
  11. Pteropus alecto (black flying fox) pal-let-7f-3p
  12. Salmo salar ssa-let-7f-3p
 Publications