Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-let-7f-3p URS00002F8148_8030

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAUACAAUCUAUUGCCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Capra hircus (goat) chi-let-7f-3p
  2. Cavia porcellus cpo-let-7f-3p
  3. Columba livia cli-let-7f-3p
  4. Dasypus novemcinctus dno-let-7f-3p
  5. Gallus gallus gga-let-7f-3p
  6. Homo sapiens hsa-let-7f-1-3p
  7. Macaca mulatta (Rhesus monkey) mml-let-7f-3p
  8. Monodelphis domestica (gray short-tailed opossum) mdo-let-7f-1-3p
  9. Mus musculus mmu-let-7f-1-3p
  10. Ophiophagus hannah (king cobra) oha-let-7f-2-3p
  11. Oryctolagus cuniculus (rabbit) ocu-let-7f-3p
  12. Pteropus alecto (black flying fox) pal-let-7f-3p