v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-29a URS00002F4D78_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGCACCAUCUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-29-P2b_3p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-29a
  3. Canis lupus familiaris cfa-miR-29a
  4. Cavia porcellus cpo-miR-29a-3p
  5. Cervus elaphus cel-miR-29a
  6. Dasypus novemcinctus dno-miR-29a-3p
  7. Daubentonia madagascariensis (aye-aye) dma-miR-29a
  8. Echinops telfairi Ete-Mir-29-P2b_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-29a
  10. Homo sapiens hsa-miR-29a-3p
  11. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-29a
  12. Macaca mulatta (Rhesus monkey) Mml-Mir-29-P2b_3p (mature (guide))
  13. Mus musculus mmu-miR-29a-3p
  14. Nomascus leucogenys nle-miR-29a
  15. Oryctolagus cuniculus (rabbit) ocu-miR-29a-3p
  16. Otolemur garnettii (small-eared galago) oga-miR-29a
  17. Papio hamadryas (hamadryas baboon) pha-miR-29a
  18. Pteropus alecto (black flying fox) pal-miR-29a-3p
  19. Rattus norvegicus rno-miR-29a-3p
  20. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1502689