Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-29a-3p URS00002F4D78_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, TarBase, IntAct, ENA, miRBase, MirGeneDB, RefSeq, PSICQUIC, MalaCards, GeneCards). Described in 115 papers. Homo sapiens (human) hsa-miR-29a-3p sequence is a product of MIR29A, miR-29a, hsa-miR-29a, miR-29, miR-29a-3p, hsa-miR-29a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 15.5K, 182-FIP, 1R20, 2-HPCL, 2F1, 2H9, 2PP2A, 3-10C.

Interactions 84

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-29a-3p interacts with:

Interaction id Participant Synonyms
ensembl:ENSG00000110395 CBL ENSG00000110395
URS00002F4D78_9606-42 ensembl:ENSG00000110395 CBL ENSG00000110395
EBI-25748301 intact:EBI-25682775 EBI-25682775 ENST00000337514 mrna_igf1
URS00002F4D78_9606-43 O15534 O15534
URS00002F4D78_9606-0 O15534 O15534
URS00002F4D78_9606-1 O43184 O43184
URS00002F4D78_9606-44 O60381 O60381
URS00002F4D78_9606-2 O60381 O60381
URS00002F4D78_9606-45 O75474 O75474
URS00002F4D78_9606-3 O75474 O75474
URS00002F4D78_9606-4 O95832 O95832
URS00002F4D78_9606-46 O95832 O95832
URS00002F4D78_9606-47 P02461 P02461
URS00002F4D78_9606-5 P02461 P02461
URS00002F4D78_9606-6 P02462 P02462
URS00002F4D78_9606-7 P02462 P02462
URS00002F4D78_9606-49 P02462 P02462
URS00002F4D78_9606-48 P02462 P02462
URS00002F4D78_9606-8 P02671 P02671
URS00002F4D78_9606-9 P05556 P05556
URS00002F4D78_9606-50 P05556 P05556
URS00002F4D78_9606-10 P05997 P05997
URS00002F4D78_9606-51 P05997 P05997
URS00002F4D78_9606-52 P06858 P06858
URS00002F4D78_9606-11 P06858 P06858
URS00002F4D78_9606-54 P08253 P08253
URS00002F4D78_9606-53 P08253 P08253
URS00002F4D78_9606-13 P08253 P08253
URS00002F4D78_9606-12 P08253 P08253
URS00002F4D78_9606-15 P08572 P08572
URS00002F4D78_9606-55 P08572 P08572
URS00002F4D78_9606-56 P08572 P08572
URS00002F4D78_9606-14 P08572 P08572
URS00002F4D78_9606-16 P09486 P09486
URS00002F4D78_9606-57 P09486 P09486
URS00002F4D78_9606-17 P10415 P10415
URS00002F4D78_9606-58 P10415 P10415
URS00002F4D78_9606-18 P15692 P15692
URS00002F4D78_9606-59 P15692 P15692
URS00002F4D78_9606-60 P19784 P19784
URS00002F4D78_9606-19 P19784 P19784
URS00002F4D78_9606-61 P23229 P23229
URS00002F4D78_9606-20 P23229 P23229
URS00002F4D78_9606-62 P28300 P28300
URS00002F4D78_9606-21 P28300 P28300
URS00002F4D78_9606-22 P30279 P30279
URS00002F4D78_9606-63 P30279 P30279
URS00002F4D78_9606-64 P31751 P31751
URS00002F4D78_9606-23 P31751 P31751
URS00002F4D78_9606-24 P35555 P35555
URS00002F4D78_9606-65 P35555 P35555
URS00002F4D78_9606-25 P40199 P40199
URS00002F4D78_9606-66 P40199 P40199
URS00002F4D78_9606-26 P50454 P50454
URS00002F4D78_9606-67 P50454 P50454
URS00002F4D78_9606-68 P56817 P56817
URS00002F4D78_9606-27 P56817 P56817
URS00002F4D78_9606-28 P60484 P60484
URS00002F4D78_9606-69 P60484 P60484
URS00002F4D78_9606-29 Q00534 Q00534
URS00002F4D78_9606-70 Q03692 Q03692
URS00002F4D78_9606-30 Q03692 Q03692
URS00002F4D78_9606-31 Q07820 Q07820
URS00002F4D78_9606-71 Q07820 Q07820
URS00002F4D78_9606-72 Q13467 Q13467
URS00002F4D78_9606-32 Q13467 Q13467
URS00002F4D78_9606-33 Q13569 Q13569
URS00002F4D78_9606-73 Q13569 Q13569
URS00002F4D78_9606-34 Q13753 Q13753
URS00002F4D78_9606-74 Q13753 Q13753
URS00002F4D78_9606-75 Q5ZPR3 Q5ZPR3
URS00002F4D78_9606-41 Q5ZPR3 Q5ZPR3
URS00002F4D78_9606-76 Q8NFU7 Q8NFU7
URS00002F4D78_9606-35 Q8NFU7 Q8NFU7
URS00002F4D78_9606-77 Q92997 Q92997
URS00002F4D78_9606-36 Q92997 Q92997
URS00002F4D78_9606-78 Q9NPG1 Q9NPG1
URS00002F4D78_9606-37 Q9NPG1 Q9NPG1
URS00002F4D78_9606-38 Q9UBC3 Q9UBC3
URS00002F4D78_9606-79 Q9UBC3 Q9UBC3
URS00002F4D78_9606-80 Q9UPY3 Q9UPY3
URS00002F4D78_9606-39 Q9UPY3 Q9UPY3
URS00002F4D78_9606-40 Q9Y6K1 Q9Y6K1
URS00002F4D78_9606-81 Q9Y6K1 Q9Y6K1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCACCAUCUGAAAUCGGUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 32 other species

    1. Bos taurus (cattle) Bta-Mir-29-P1a_3p (mature (guide))
    2. Callithrix jacchus cja-miR-29a
    3. Canis lupus familiaris cfa-miR-29a
    4. Cavia porcellus (domestic guinea pig) cpo-miR-29a-3p
    5. Cervus elaphus (red deer) cel-miR-29a
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29a-3p
    7. Daubentonia madagascariensis (aye-aye) dma-miR-29a
    8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-29-P1a_3p (mature (guide))
    9. Equus caballus (horse) eca-miR-29a
    10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-29a
    11. Macaca mulatta Mml-Mir-29-P1a_3p (mature (guide))
    12. Microcebus murinus mmr-miR-29a
    13. Mus musculus (house mouse) mmu-miR-29a-3p
    14. Nomascus leucogenys nle-miR-29a
    15. Oryctolagus cuniculus (rabbit) ocu-miR-29a-3p
    16. Otolemur garnettii oga-miR-29a
    17. Papio hamadryas (hamadryas baboon) pha-miR-29a
    18. Pteropus alecto pal-miR-29a-3p
    19. Rattus norvegicus rno-miR-29a-3p
    20. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1502689