Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-29a-3p URS00002F4D78_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUCUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-29-P2b_3p (mature (guide))
  2. Callithrix jacchus cja-miR-29a
  3. Canis lupus familiaris (dog) cfa-miR-29a
  4. Cavia porcellus cpo-miR-29a-3p
  5. Cervus elaphus cel-miR-29a
  6. Daubentonia madagascariensis dma-miR-29a
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-29-P2b_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-29a
  9. Homo sapiens hsa-miR-29a-3p
  10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-29a
  11. Macaca mulatta (Rhesus monkey) Mml-Mir-29-P2b_3p (mature (guide))
  12. Microcebus murinus mmr-miR-29a
  13. Mus musculus (house mouse) mmu-miR-29a-3p
  14. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29a
  15. Oryctolagus cuniculus (rabbit) ocu-miR-29a-3p
  16. Otolemur garnettii (small-eared galago) oga-miR-29a
  17. Papio hamadryas (hamadryas baboon) pha-miR-29a
  18. Pteropus alecto (black flying fox) pal-miR-29a-3p
  19. Rattus norvegicus rno-miR-29a-3p
  20. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1502689