Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-762 URS00002EEDBE_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-762: Mmu-mir-762 is a microRNA that was found to be significantly up-regulated in various studies [PMC5032015] [PMC4807979] [PMC4693154] [PMC7453657]. It was differentially expressed after 7 days of osteogenic differentiation compared to basal conditions [PMC4807979]. Mmu-mir-762 was also found to be elevated in mouse species [PMC4693154]. It has been shown to interact with other microRNAs and differentially expressed genes in various experiments [PMC7453657]. Mmu-mir-762 has been used in microRNA knockdown experiments and its high concentration has been shown to arrest the cell cycle of mouse colon cancer cells at the G0/G1 phase, suggesting its role in cell cycle progression [PMC5131337] [PMC9110863]. It is not similar in sequence to the miR-34 family miRNAs, but it has been examined alongside them for confirmation of array data and functional research purposes [PMC3091750]. Mmu-mir-762 has also been identified as one of the upregulated miRNAs in cancer tissues, suggesting its potential role as a biomarker for cancer diagnosis or prognosis [PMC3835097]. However, it is not known to have been reported in any tumors at present and further research is needed on its functional role and potential clinical applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGCUGGGGCCGGGACAGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications