Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-744 URS00002ED61F_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-744: Ssc-mir-744 is a microRNA that has been found to be differentially expressed in various studies. It has been shown to be downregulated in different tissues, including muscles after ischemia-reperfusion injury [PMC6737989]. Ssc-mir-744 has also been implicated in the regulation of Th1/Th2 cell differentiation and the polarization of immune responses during T. gondii infection [PMC8851844]. In addition, ssc-mir-744 has been identified as a potential regulator of PRRSV infection and immune response [PMC10000162]. It is worth noting that ssc-mir-744 has been found to have binding sites in the 3'UTR of RFX2, a transcription factor involved in various cellular processes [PMC10010159]. The regulation of RFX2 by ssc-mir-744 has been confirmed through dual-luciferase reporter assays [PMC10010159]. Furthermore, ssc-mir-744 is part of a network of miRNAs involved in myogenesis and skeletal muscle stem cell quiescence [PMC6737989]. Overall, ssc-mir-744 appears to have diverse roles in different biological processes and may serve as a potential therapeutic target or biomarker for various conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCGGGGCUAGGGCUAACAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) bta-miR-744
  2. Canis lupus familiaris Cfa-Mir-744_5p (mature (guide))
  3. Cavia porcellus (domestic guinea pig) cpo-miR-744-5p
  4. Dasypus novemcinctus dno-miR-744-5p
  5. Echinops telfairi Ete-Mir-744_5p (mature (guide))
  6. Homo sapiens hsa-miR-744-5p
  7. Macaca fascicularis microRNA miR-744-5p
  8. Macaca mulatta (Rhesus monkey) Mml-Mir-744_5p (mature (guide))
  9. Mus musculus mmu-miR-744-5p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-744-5p
  11. Pan troglodytes (chimpanzee) ptr-miR-744
  12. Pongo pygmaeus ppy-miR-744
  13. Rattus norvegicus (Norway rat) Rno-Mir-744_5p (mature (guide))
Publications