Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-744 URS00002ED61F_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCGGGGCUAGGGCUAACAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) bta-miR-744
  2. Canis lupus familiaris Cfa-Mir-744_5p (mature (guide))
  3. Cavia porcellus (domestic guinea pig) cpo-miR-744-5p
  4. Dasypus novemcinctus dno-miR-744-5p
  5. Echinops telfairi Ete-Mir-744_5p (mature (guide))
  6. Homo sapiens hsa-miR-744-5p
  7. Macaca fascicularis microRNA miR-744-5p
  8. Macaca mulatta (Rhesus monkey) Mml-Mir-744_5p (mature (guide))
  9. Mus musculus mmu-miR-744-5p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-744-5p
  11. Pongo pygmaeus ppy-miR-744
  12. Rattus norvegicus (Norway rat) Rno-Mir-744_5p (mature (guide))
  13. Sus scrofa (pig) ssc-miR-744
Publications