Cavia porcellus (domestic guinea pig) cpo-miR-744-5p URS00002ED61F_10141

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 13 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGCGGGGCUAGGGCUAACAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Bos taurus (cattle) bta-miR-744
2. Canis lupus familiaris Cfa-Mir-744_5p (mature (guide))
3. Dasypus novemcinctus dno-miR-744-5p
4. Echinops telfairi Ete-Mir-744_5p (mature (guide))
5. Homo sapiens hsa-miR-744-5p
6. Macaca fascicularis microRNA miR-744-5p
7. Macaca mulatta (Rhesus monkey) Mml-Mir-744_5p (mature (guide))
8. Mus musculus mmu-miR-744-5p
9. Oryctolagus cuniculus (rabbit) ocu-miR-744-5p
10. Pan troglodytes (chimpanzee) ptr-miR-744
11. Pongo pygmaeus ppy-miR-744
12. Rattus norvegicus (Norway rat) Rno-Mir-744_5p (mature (guide))
13. Sus scrofa (pig) ssc-miR-744

Download

• FASTA
• JSON