Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1477 tRNA-Val secondary structure diagram

Saccharomyces cerevisiae YJM1477 tRNA-Val URS00002ECE7F_1294379

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAGAUUAGCUUAAUUGGUAUAGCAUUCGUUUUACACACGAAAGAUUAUAGGUUCGAACCCUAUAUUUCCUAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 98 other species

  1. Saccharomyces cerevisiae tRNA-Val
  2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Val
  3. Saccharomyces cerevisiae PE-2 tRNA-Val
  4. Saccharomyces cerevisiae S288C tRNA-Val
  5. Saccharomyces cerevisiae YJM1078 tRNA-Val
  6. Saccharomyces cerevisiae YJM1083 tRNA-Val
  7. Saccharomyces cerevisiae YJM1129 tRNA-Val
  8. Saccharomyces cerevisiae YJM1133 tRNA-Val
  9. Saccharomyces cerevisiae YJM1190 tRNA-Val
  10. Saccharomyces cerevisiae YJM1199 tRNA-Val
  11. Saccharomyces cerevisiae YJM1202 tRNA-Val
  12. Saccharomyces cerevisiae YJM1208 tRNA-Val
  13. Saccharomyces cerevisiae YJM1242 tRNA-Val
  14. Saccharomyces cerevisiae YJM1244 tRNA-Val
  15. Saccharomyces cerevisiae YJM1248 tRNA-Val
  16. Saccharomyces cerevisiae YJM1250 tRNA-Val
  17. Saccharomyces cerevisiae YJM1252 tRNA-Val
  18. Saccharomyces cerevisiae YJM1273 tRNA-Val
  19. Saccharomyces cerevisiae YJM1304 tRNA-Val
  20. Saccharomyces cerevisiae YJM1307 tRNA-Val
  21. Saccharomyces cerevisiae YJM1311 tRNA-Val
  22. Saccharomyces cerevisiae YJM1326 tRNA-Val
  23. Saccharomyces cerevisiae YJM1332 tRNA-Val
  24. Saccharomyces cerevisiae YJM1336 tRNA-Val
  25. Saccharomyces cerevisiae YJM1338 tRNA-Val
  26. Saccharomyces cerevisiae YJM1341 tRNA-Val
  27. Saccharomyces cerevisiae YJM1342 tRNA-Val
  28. Saccharomyces cerevisiae YJM1355 tRNA-Val
  29. Saccharomyces cerevisiae YJM1356 tRNA-Val
  30. Saccharomyces cerevisiae YJM1381 tRNA-Val
  31. Saccharomyces cerevisiae YJM1383 tRNA-Val
  32. Saccharomyces cerevisiae YJM1385 tRNA-Val
  33. Saccharomyces cerevisiae YJM1386 tRNA-Val
  34. Saccharomyces cerevisiae YJM1387 tRNA-Val
  35. Saccharomyces cerevisiae YJM1388 tRNA-Val
  36. Saccharomyces cerevisiae YJM1389 tRNA-Val
  37. Saccharomyces cerevisiae YJM1400 tRNA-Val
  38. Saccharomyces cerevisiae YJM1401 tRNA-Val
  39. Saccharomyces cerevisiae YJM1402 tRNA-Val
  40. Saccharomyces cerevisiae YJM1415 tRNA-Val
  41. Saccharomyces cerevisiae YJM1417 tRNA-Val
  42. Saccharomyces cerevisiae YJM1418 tRNA-Val
  43. Saccharomyces cerevisiae YJM1419 tRNA-Val
  44. Saccharomyces cerevisiae YJM1433 tRNA-Val
  45. Saccharomyces cerevisiae YJM1434 tRNA-Val
  46. Saccharomyces cerevisiae YJM1439 tRNA-Val
  47. Saccharomyces cerevisiae YJM1443 tRNA-Val
  48. Saccharomyces cerevisiae YJM1444 tRNA-Val
  49. Saccharomyces cerevisiae YJM1447 tRNA-Val
  50. Saccharomyces cerevisiae YJM1450 tRNA-Val
  51. Saccharomyces cerevisiae YJM1460 tRNA-Val
  52. Saccharomyces cerevisiae YJM1463 tRNA-Val
  53. Saccharomyces cerevisiae YJM1478 tRNA-Val
  54. Saccharomyces cerevisiae YJM1479 tRNA-Val
  55. Saccharomyces cerevisiae YJM1526 tRNA-Val
  56. Saccharomyces cerevisiae YJM1527 tRNA-Val
  57. Saccharomyces cerevisiae YJM1549 tRNA-Val
  58. Saccharomyces cerevisiae YJM1573 tRNA-Val
  59. Saccharomyces cerevisiae YJM1574 tRNA-Val
  60. Saccharomyces cerevisiae YJM1592 tRNA-Val
  61. Saccharomyces cerevisiae YJM1615 tRNA-Val
  62. Saccharomyces cerevisiae YJM189 tRNA-Val
  63. Saccharomyces cerevisiae YJM193 tRNA-Val
  64. Saccharomyces cerevisiae YJM195 tRNA-Val
  65. Saccharomyces cerevisiae YJM244 tRNA-Val
  66. Saccharomyces cerevisiae YJM248 tRNA-Val
  67. Saccharomyces cerevisiae YJM270 tRNA-Val
  68. Saccharomyces cerevisiae YJM271 tRNA-Val
  69. Saccharomyces cerevisiae YJM320 tRNA-Val
  70. Saccharomyces cerevisiae YJM326 tRNA-Val
  71. Saccharomyces cerevisiae YJM428 tRNA-Val
  72. Saccharomyces cerevisiae YJM450 tRNA-Val
  73. Saccharomyces cerevisiae YJM451 tRNA-Val
  74. Saccharomyces cerevisiae YJM453 tRNA-Val
  75. Saccharomyces cerevisiae YJM456 tRNA-Val
  76. Saccharomyces cerevisiae YJM470 tRNA-Val
  77. Saccharomyces cerevisiae YJM541 tRNA-Val
  78. Saccharomyces cerevisiae YJM554 tRNA-Val
  79. Saccharomyces cerevisiae YJM555 tRNA-Val
  80. Saccharomyces cerevisiae YJM627 tRNA-Val
  81. Saccharomyces cerevisiae YJM681 tRNA-Val
  82. Saccharomyces cerevisiae YJM682 tRNA-Val
  83. Saccharomyces cerevisiae YJM683 tRNA-Val
  84. Saccharomyces cerevisiae YJM689 tRNA-Val
  85. Saccharomyces cerevisiae YJM693 tRNA-Val
  86. Saccharomyces cerevisiae YJM789 tRNA-Val
  87. Saccharomyces cerevisiae YJM969 tRNA-Val
  88. Saccharomyces cerevisiae YJM972 tRNA-Val
  89. Saccharomyces cerevisiae YJM975 tRNA-Val
  90. Saccharomyces cerevisiae YJM978 tRNA-Val
  91. Saccharomyces cerevisiae YJM981 tRNA-Val
  92. Saccharomyces cerevisiae YJM984 tRNA-Val
  93. Saccharomyces cerevisiae YJM987 tRNA-Val
  94. Saccharomyces cerevisiae YJM990 tRNA-Val
  95. Saccharomyces cerevisiae YJM993 tRNA-Val
  96. Saccharomyces cerevisiae YJM996 tRNA-Val
  97. Saccharomyces kudriavzevii tRNA-Val
  98. Saccharomyces mikatae tRNA-Val
2D structure