Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-151a precursor URS00002ECE14_9606

  • 90 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 12 species

Automated summary: This pre miRNA sequence is 90 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, Ensembl/GENCODE, RefSeq, MalaCards, HGNC, ENA, Ensembl, GeneCards). Described in 38 papers. Matches 1 Rfam family (mir-28, RF00655). Homo sapiens (human) microRNA hsa-mir-151a precursor sequence is a product of mir-151a precurso, MIR151A, mir-151a, hsa-mir-151a precursor, mir-151a precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCCCUACUAGACUGAAGCUCCUUGAGGACAGGGAUGGUCAUACUCACCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Colobus angolensis palliatus miRNA
    3. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 151a
    4. Macaca fascicularis (Crab-eating macaque) miRNA
    5. Macaca mulatta microRNA mml-mir-151 precursor
    6. Macaca nemestrina miRNA
    7. Mandrillus leucophaeus (Drill) miRNA
    8. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    9. Pan paniscus (bonobo) miRNA
    10. Pan troglodytes (chimpanzee) ptr-mir-151
    11. Papio anubis (Olive baboon) miRNA
    12. Rhinopithecus bieti miRNA
    13. Rhinopithecus roxellana miRNA